PDA

View Full Version : The Celts were G2a2b2a1b L497 ( Hallstatt Y-DNA from Mitterkirchen, Upper Austria 700



Robert6
14-02-15, 23:51
The Celts were G2a2b2a1b L497 ( Hallstatt Y-DNA from Mitterkirchen, Upper Austria 700BC)
10 marker matches from the region close to the Celtic ancient dna
2NWM5 Warren Zweisimmen, Switzerland Unknown Family Tree DNA 12 0
ABZX5 Beery Oberdiessbach, Switzerland G (tested) Family Tree DNA 12 0
NHMCH Willi Switzerland G2a3b1 (tested) Family Tree DNA 12 0
Z8UD6 Häfeli Switzerland Unknown Family Tree DNA 12 0
ZZQU9 Boyer Switzerland Unknown Family Tree DNA 12 0

Tabelle 2: Y-chromosomales DNA-Profile HÜ-I / 8
Tabelle 1: DNA-Profile HÜ-X / 1 und HÜ-I / 8
Objekt
06
Merkmal. DYS391 DYS389I DYS439 DYS389II DYS438 DYS437
HÜ-I / 8 10 12 11 29 10 16
Merkmal. DYS19 DYS392 DYS393 DYS390 DYS385
HÜ-I / 8 15 11 14 22 14 14

Ancient DNA from here
http://sonius.at/pdf/Sonius_07_WEB.pdf

Angela
15-02-15, 03:59
The Celts were G2a2b2a1b L497 ( Hallstatt Y-DNA from Mitterkirchen, Upper Austria 700BC)
10 marker matches from the region close to the Celtic ancient dna
2NWM5 Warren Zweisimmen, Switzerland Unknown Family Tree DNA 12 0
ABZX5 Beery Oberdiessbach, Switzerland G (tested) Family Tree DNA 12 0
NHMCH Willi Switzerland G2a3b1 (tested) Family Tree DNA 12 0
Z8UD6 Häfeli Switzerland Unknown Family Tree DNA 12 0
ZZQU9 Boyer Switzerland Unknown Family Tree DNA 12 0

Tabelle 2: Y-chromosomales DNA-Profile HÜ-I / 8
Tabelle 1: DNA-Profile HÜ-X / 1 und HÜ-I / 8
Objekt
06
Merkmal. DYS391 DYS389I DYS439 DYS389II DYS438 DYS437
HÜ-I / 8 10 12 11 29 10 16
Merkmal. DYS19 DYS392 DYS393 DYS390 DYS385
HÜ-I / 8 15 11 14 22 14 14

Ancient DNA from here
http://sonius.at/pdf/Sonius_07_WEB.pdf

Could you elaborate Robert? Are you saying that ancient dna has been typed at a Hallstatt site, or that these are the results of modern people from that area, or both?

skaheen15
15-02-15, 07:04
Well, "The Celts" almost certainly belonged to a variety of Y-dna haplogroups, like any other large ethnic family. Maybe G2a2b2a1b L497 was among them, but, your blanket statement dosen't really make any sense.

Robert6
15-02-15, 12:58
Could you elaborate Robert? Are you saying that ancient dna has been typed at a Hallstatt site, or that these are the results of modern people from that area, or both?
These are STR markers of ancient DNA of a man from Proto-Celtic culture
Hallstatt site Austria 2700 BP

Tabelle 2: Y-chromosomales DNA-Profile HÜ-I / 8
Tabelle 1: DNA-Profile HÜ-X / 1 und HÜ-I / 8
Objekt
06
Merkmal. DYS391 DYS389I DYS439 DYS389II DYS438 DYS437
HÜ-I / 8 10 12 11 29 10 16
Merkmal. DYS19 DYS392 DYS393 DYS390 DYS385
HÜ-I / 8 15 11 14 22 14 14

The STR markers are in page 6
http://sonius.at/pdf/Sonius_07_WEB.pdf

bicicleur
15-02-15, 13:07
These are STR markers of ancient DNA of a man from Proto-Celtic culture
Hallstatt site Austria 2700 BC

Tabelle 2: Y-chromosomales DNA-Profile HÜ-I / 8
Tabelle 1: DNA-Profile HÜ-X / 1 und HÜ-I / 8
Objekt
06
Merkmal. DYS391 DYS389I DYS439 DYS389II DYS438 DYS437
HÜ-I / 8 10 12 11 29 10 16
Merkmal. DYS19 DYS392 DYS393 DYS390 DYS385
HÜ-I / 8 15 11 14 22 14 14

The STR markers are in page 6
http://sonius.at/pdf/Sonius_07_WEB.pdf

and where can we find the link between these STR and L497 ?

Robert6
15-02-15, 13:17
and where can we find the link between these STR and L497 ?
In Ysearch it is the biggest haplotype base
http://www.ysearch.org/search_search.asp?uid=&freeentry=true


10 marker matches of ancient DNA from the region close to the Proto-Celtic sites, all of them are G and they all of them have dys388=13 (which is L497 subclade)
2NWM5 Warren Zweisimmen, Switzerland Unknown Family Tree DNA 12 0
ABZX5 Beery Oberdiessbach, Switzerland G (tested) Family Tree DNA 12 0
NHMCH Willi Switzerland G2a3b1 (tested) Family Tree DNA 12 0
Z8UD6 Häfeli Switzerland Unknown Family Tree DNA 12 0
ZZQU9 Boyer Switzerland Unknown Family Tree DNA 12 0

Angela
15-02-15, 14:18
The presence of this sub-clade among them obviously doesn't mean others were not, as was pointed out above, but it is interesting. In Boattini et al they showed five separate sets of G2a in Italy, with one arriving very late, and predominantly found in the north.

Sile
15-02-15, 17:51
These are STR markers of ancient DNA of a man from Proto-Celtic culture
Hallstatt site Austria 2700 BC

Tabelle 2: Y-chromosomales DNA-Profile HÜ-I / 8
Tabelle 1: DNA-Profile HÜ-X / 1 und HÜ-I / 8
Objekt
06
Merkmal. DYS391 DYS389I DYS439 DYS389II DYS438 DYS437
HÜ-I / 8 10 12 11 29 10 16
Merkmal. DYS19 DYS392 DYS393 DYS390 DYS385
HÜ-I / 8 15 11 14 22 14 14

The STR markers are in page 6
http://sonius.at/pdf/Sonius_07_WEB.pdf

he is clearly not a celt, they did not reach the alps until the early iron-age

more likely a proto-illyrian or proto-raetic person

Robert6
15-02-15, 18:53
he is clearly not a celt, they did not reach the alps until the early iron-age

more likely a proto-illyrian or proto-raetic person
It is in Mitterkirchen close to the River
250 meters above the Sea level, not in Alps
and is from 700 BC
he is proto-Celtic

bicicleur
15-02-15, 20:10
In Ysearch it is the biggest haplotype base
http://www.ysearch.org/search_search.asp?uid=&freeentry=true


10 marker matches of ancient DNA from the region close to the Proto-Celtic sites, all of them are G and they all of them have dys388=13 (which is L497 subclade)
2NWM5 Warren Zweisimmen, Switzerland Unknown Family Tree DNA 12 0
ABZX5 Beery Oberdiessbach, Switzerland G (tested) Family Tree DNA 12 0
NHMCH Willi Switzerland G2a3b1 (tested) Family Tree DNA 12 0
Z8UD6 Häfeli Switzerland Unknown Family Tree DNA 12 0
ZZQU9 Boyer Switzerland Unknown Family Tree DNA 12 0

this one is also in the list :

H7WYZ Reich Baden-W¨rtemberg Germany , as close as Switzerland

He is G1* but also dys 388 = 13

Maciamo
15-02-15, 20:36
G2a-L497 falls under what I usually call G2a3b1, the Indo-European branch of G2a (http://www.eupedia.com/europe/Haplogroup_G2a_Y-DNA.shtml#Indo-European). Hence it is not surprising that Hallstatt Celts possessed this lineage, especially considering that the Alps are a hotspot for G2a3b1 today. The Bronze Age Proto-Celts relied heavily on copper and tin mining to sustain their economy, military and prestige goods for their nobility. This partially explains why the Hallstatt culture came into being and flourished in a metal-rich region like the Alps.

That being said, it is surprising that this article was published in 2010 and no one has ever mentioned these ancient Y-DNA samples before !

Robert6
15-02-15, 20:46
this one is also in the list :

H7WYZ Reich Baden-W¨rtemberg Germany , as close as Switzerland

He is G1* but also dys 388 = 13
H7WYZ Reich Baden is L497 G2a2b2a1b
In Ftdna the G2 now is G1

Reich Baden have
DYS425=14 this mean that he is G2a2b
DYS425=14 and dys388 = 13 mean that he is L497 G2a2b2a1b

skaheen15
15-02-15, 21:41
But, in 2700 BCE? That's almost 2000 years before Hallstatt, and only a few hundred years after Otzi. Indo-European, maybe, but Celtic? Don't think so.

Robert6
15-02-15, 21:56
The article in English
https://www.google.gr/url?sa=t&rct=j&q=&esrc=s&source=web&cd=2&cad=rja&uact=8&ved=0CCkQFjAB&url=http%3A%2F%2Fwww.researchgate.net%2Fprofile%2F Franz_Neuhuber%2Fpublication%2F264811880_Ancient_D NA_Y-chromosomal_DNA_Fingerprinting_in_Molecular_Archae ology_-_Paternal_Pedigrees_and_their_Potential_Geographic al_Correlates%2Flinks%2F53f225c70cf2f2c3e7fcc5c1.p df&ei=DgHhVKfbJoP3UvSkgNAJ&usg=AFQjCNGeADYeXIjPuBgqOCqTjeTsJGnddg&sig2=Sq9CeP1UKs5u0k2R6Y1h2A&bvm=bv.85970519,d.d2s

skaheen15
15-02-15, 21:56
Just saw that the "2" was a typo. Pardon me. Interesting data there. G would still have certainly been a minority lineage among Celts, though.

Robert6
15-02-15, 22:00
But, in 2700 BCE? That's almost 2000 years before Hallstatt, and only a few hundred years after Otzi. Indo-European, maybe, but Celtic? Don't think so.
I' am sorry my mistake it is 2700BP, 700BC, and not 2700BC.

Melancon
15-02-15, 22:07
It is generally thought that the proto-Celts were the highest bearers of R1b. Along with the proto-Italics.


Celts could not be G2a Y-DNA dominant; this is very unlikely as G2a is not an Indo-European Y chromosome. If Celts had G2a; they likely assimilated non-Indo-European men into their Celtic tribe.

Robert6
15-02-15, 22:17
It is generally thought that the proto-Celts were the highest bearers of R1b. Along with the proto-Italics.


Celts could not be G2a Y-DNA dominant; this is very unlikely as G2a is not an Indo-European Y chromosome. If Celts had G2a; they likely assimilated non-Indo-European men into their Celtic tribe.
If we take the Anatolian theory then the G2a is Indo-European
While the Dene-Caucasian(Basque Etrouscan + Picts in Britain) from Siberia could be the language of R1 people

Fluffy
15-02-15, 22:35
It is generally thought that the proto-Celts were the highest bearers of R1b. Along with the proto-Italics.


Celts could not be G2a Y-DNA dominant; this is very unlikely as G2a is not an Indo-European Y chromosome. If Celts had G2a; they likely assimilated non-Indo-European men into their Celtic tribe.

And this theory of G2a being non Indo European, is based on what?

skaheen15
15-02-15, 22:37
If we take the Anatolian theory then the G2a is Indo-European
While the Dene-Caucasian(Basque Etrouscan + Picts in Britain) from Siberia could be the language of R1 people

Sure, but, who wants to take the Anatolian theory?:laughing:
As Maciamo explained, G2 lineages would have been present amongst Celtic tribes in small numbers by that time, along with other Neolithic lineages. No Renfrew necessary.

Robert6
15-02-15, 22:59
who wants to take the Anatolian theory?:laughing:

The Glottochronology wants for PIE 8.5Ky or 8.7Ky or 8.4Ky

http://img855.imageshack.us/img855/6001/sumerianhurrianpresenta.jpg
http://1.bp.blogspot.com/-SGa4Hri-95Y/UDaTQMRwSrI/AAAAAAAAFtE/bltnoSGcxNk/s1600/ieorigins.png

+

http://3.bp.blogspot.com/-UK6uv6RZBlw/TZr4U1kHkKI/AAAAAAAADbY/jvqITDejMG0/s1600/nature.jpg

+

http://dienekes.blogspot.gr/2011/04/ryder-and-nicholls-proto-indo-european.html

skaheen15
15-02-15, 23:32
That method has been roundly criticized, and for good reason, mainly because it yields wacky results that don't make any sense.
The PIE lexicon definitely seems to belong to a chalcolithic culture, one which had the wheel(neolithic Anatolia did not), and the combined weight of the archeological, genetic, and linguistic evidence does not point to an Anatolian origin for PIE, certainly not in the neolithic. There's a reason why very few scholars take the Anatolian hypothesis seriously, and, again, it's not needed to explain the presence of G in a Celtic culture.

Alan
16-02-15, 00:05
I remember when in the past I had this feeling Celts would all be like R1b, G2a and some J1. :grin:

Alan
16-02-15, 00:07
To make it clear. The only three remaining possible theories are.

1. Herders from Zagros/North Mesopotamia/East Anatolia 2. PC Steppes 3. South_Central Asia

I was always in favor of nr.1

Fluffy
16-02-15, 00:26
The reason G2a3b1 is considered Indo European is because it's found in India, the Kalash, and Iranian people, as well as throughout Europe. It may not be a big Haplogroup but that doesn't mean it's non Indo European. Its spread is clearly of Indo European origins.

Robert6
16-02-15, 00:35
That method has been roundly criticized, and for good reason, mainly because it yields wacky results that don't make any sense.
The PIE lexicon definitely seems to belong to a chalcolithic culture, one which had the wheel(neolithic Anatolia did not), and the combined weight of the archeological, genetic, and linguistic evidence does not point to an Anatolian origin for PIE, certainly not in the neolithic. There's a reason why very few scholars take the Anatolian hypothesis seriously, and, again, it's not needed to explain the presence of G in a Celtic culture.
Halafian culture(mostly ENF) had the first wheels
Eneolithic began in Serbia(mostly EEF) 7000 years ago

skaheen15
16-02-15, 00:54
Halafian culture(mostly ENF) had the first wheels
Eneolithic began in Serbia(mostly EEF) 7000 years ago

Those Halafian wheels you're referring to had to do with pottery, not quite the same thing. And in any case, that's just one thing.
Vinca, which did do some limited work with copper, was definitely a farming culture, the PIE lexicon seems to belong to a mobile, pastoralist culture. We can split hairs all day, but the weight of the evidence definitely does not favor the Anatolian theory, even Renfrew himself modified it to the point where it was practically a different thing altogether.

Robert6
16-02-15, 01:34
Those Halafian wheels you're referring to had to do with pottery, not quite the same thing. And in any case, that's just one thing.
Vinca, which did do some limited work with copper, was definitely a farming culture, the PIE lexicon seems to belong to a mobile, pastoralist culture. We can split hairs all day, but the weight of the evidence definitely does not favor the Anatolian theory, even Renfrew himself modified it to the point where it was practically a different thing altogether.
Funnelbeaker culture(TRB) and Maykop culture had the first wagons


Halaf->Ubaid->Tepe Gawra->Maykop
Halaf had wheels
Maykop had wagons

Sile
16-02-15, 06:51
Sure, but, who wants to take the Anatolian theory?:laughing:
As Maciamo explained, G2 lineages would have been present amongst Celtic tribes in small numbers by that time, along with other Neolithic lineages. No Renfrew necessary.

this paper deals with G in austria and especially G-L497, data , maps, origins etc

http://www.blutspendezuerich.ch/Media/File/Publikationen%202013/High%20resolution%20mapping%20of%20Y%20haplogroup% 20G%282%29.pdf

L497 was born in Austria and it was not celtic

skaheen15
16-02-15, 07:51
Funnelbeaker culture(TRB) and Maykop culture had the first wagons Halaf->Ubaid->Tepe Gawra->Maykop Halaf had wheels Maykop had wagons Halaf had the potter's wheel. As for Funnelbeaker and Maikop, no arguments there, but, again, none of that points to the Anatolian hypothesis as represented by those glottochronological studies being correct.

skaheen15
16-02-15, 07:53
this paper deals with G in austria and especially G-L497, data , maps, origins etc http://www.blutspendezuerich.ch/Media/File/Publikationen%202013/High%20resolution%20mapping%20of%20Y%20haplogroup% 20G%282%29.pdf L497 was born in Austria and it was not celtic I never said that L497 was Celtic, the OP did.

Alan
16-02-15, 07:58
this paper deals with G in austria and especially G-L497, data , maps, origins etc

http://www.blutspendezuerich.ch/Media/File/Publikationen%202013/High%20resolution%20mapping%20of%20Y%20haplogroup% 20G%282%29.pdf

L497 was born in Austria and it was not celtic

But wasn't the celtic branch itself born somewhere there? So why shouldn't it be possible (especially after G2a was found in the Hallstatt culture which is considered as proto_celtic) that G2a was part of the proto_celtic development. It doesn't mean that Celts were entirely G2a.

Sile
16-02-15, 09:16
But wasn't the celtic branch itself born somewhere there? So why shouldn't it be possible (especially after the finallstatt culture which is considered as proto_celtic) that G2a was part of the proto_celtic development. It doesn't mean that Celts were entirely G2a.

celts where mainly R-U152

the G2 they had was most likely a branch from the ones recently found in the haak paper

celtic origin is where the royals tombs are ..in central germany near franfurt IIRC. but where not germans/ic



why are the celts in austria in the bronze age?
what about the helvetic people, raetic people, noricum people. they where not celts .....in swiss and austria

bicicleur
16-02-15, 10:43
Funnelbeaker culture(TRB) and Maykop culture had the first wagons


Halaf->Ubaid->Tepe Gawra->Maykop
Halaf had wheels
Maykop had wagons

why do you think Halaf were G2a2 ?

http://www.eupedia.com/forum/threads/30863-the-origin-of-the-early-european-farmer

Melancon
16-02-15, 11:31
If we take the Anatolian theory then the G2a is Indo-European
While the Dene-Caucasian(Basque Etrouscan + Picts in Britain) from Siberia could be the language of R1 peoplethat "theory" is beyond idiotic. Sorry

Angela
16-02-15, 13:59
This is an awful lot of speculation and a great deal of conflating of genes and languages.

Obviously, as has been stated both by me and by Alan, the presence of this particular G2a lineage in this culture does not mean that other lineages were not present.

As to whether this particular lineage descends from a Neolithic farmer in central Europe or originated in the east and could have been part of original Indo-European expansions, I don't know.

This is what the authors of the Wiki article have to say:
The L91 SNP that characterizes the G2a2b group was identified in spring 2009 at Family Tree DNA. G2a2b would seem to encompass a significant group of G persons. L91 is found so far in scattered parts of Europe and North Africa and in Armenia (http://en.wikipedia.org/wiki/Armenia). Included within G2a2b are some men with double values for STR marker DYS19, but there are also G2a2 men with this finding who are not G2a2b. The double 19 value situation is not seen in the G2a1 and G2a3 subgroups. The L91 mutation is found at 21327383 and rs35474563 on the Y-chromosome. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. The mutation involves a change from C to T.[16] L223 is found on the Y chromosome at rs13304806.

This is a link to the FTDNA project:
https://www.familytreedna.com/public/G-YDNA/

This is all separate from discussions of the Ivanov Armenian uhrheimat vs the Pontic Caspian urheimat for the Indo-European migrations. A G2a lineage could be part of the Indo-European expansion whether or not the ultimate origin was in the Armenian highlands with the second stage in the Pontic Caspian steppe or whether the Pontic Caspian steppe is "the" ultimate origin.

Fluffy
16-02-15, 17:04
that "theory" is beyond idiotic. Sorry

And your theory that Haplogroup G2a L497 is not Indo European is idiotic. Sorry.

Robert6
17-02-15, 00:11
I think that the early Kurgan people(Leila-Tepe Maykop and Kurganized Yamna) had Satem languages
Albanians + Armenians have many Z2103 and Albanians + Armenians are Satem.
Kurgan people invaded the Europe but didn't change the Languages.
Like the Satem, Sarmatians Alanians and European Huns(with Leto-Slavic or Iranian words "Med" "Strava" etc)
also invaded the Europe but didn't change the Languages


But Satem languages existed before the Kurgan people.
The ancestor cultures to Kurgan cultures are Gawra Ubaid Samarra(not to be confused to Samara) and Halaf, all four cultures were in Mesopotamia-Syria.
There is Euphratian substratum in Sumerian.
Euphratian languages possibly were IE, and possibly were ancestors of Satem languages.
Luvian languages were Satem according to some scholars, while the Hittite "newcomer" from Europe was Kentum.


About the ANE autosomal component
Caucasians Burusho Ket all are Dene-Caucasian have more ANE than others in Eurasia
From Ancient Dna we know that haplogroup R Paleolithic people had almost 100% ANE

So the G2a among Proto-Celtic Iron age people is expected

MOESAN
17-02-15, 23:36
I have been surprised by this newthread
it is based upon only a supposedHaplogroups based itself upon an haplotype, found in aHallstatt site -
Hallstatt = place + period – here itwould be about 700 BC what is Hallstatt culture OK – but if Celtswere Y-R1b as a majority (a strong one) they could have integratedY-G2a ; that does not do Celts = Y-G2a ! - at the contrary,one could base an other theory upon this apparent local SNP and say,as it is very « highlander » regionally speaking it is THE non-I-Ean core ofRhaetic people having preceded Celts there! And if Rhaeti werelate neolithical people ? All the way all that is stillspeculation (I 'm not opposed by nature but I prefer doing bets uponmore data) - I don't speak here of the I-Ean craddle battle: no argument here to resolve this question!
I red some forumers considering Celtsappeared in History about the Iron Age in West-Central Europe – Itis true, the La Tène culture is linked to Celts –
Hallsttat = Celts ??? The wholeHallstatt culture ? Less sure !
And Celtic languages seem having beenspoken in Western Iberia before the Iron Age and the famous CentralIberia Celtiberians – Henri HUBERT was playing with the concept ofpossible Gaelic speakers in the Isles at the british Bell Beakers(Round Barrows) times, came from N-W Germany Rhine mouth -


to SILE : L247 is maybe born inAustria, maybe not, it is there it is the most frequent (but if I red well, one present in Baden culture? where in Baden ???)– but L247is the descendant of L140, « brother » to L694 and M278and found also in Northern and Western Europe – these three HaploGsare « sons » of P303, very common SNP present from Iberiato Iran if what I red was serious - what appears is it would bearrived from East across Continental Europe not across MediterraneaSea, so possible arrival among some I-Eans tribes from somewhere I donot take the risk to precise –
the L91 type and its « brother »M286 types are more certainly linked to Anatolia and MediterranianNeolithics moves – M406, « brother » to L141-1 itself« father » P303 is linked to Anatolia and Levant too butits high presence specifically in Italy could correspond to acolonization younger than Neolithic but distinct to the more widelyspred of L141-1 downtreams SNPs in Europe – M406 = Greeks ? Ora Chalcolithic (Copper) intrusion through North, from Balkans ?I lack precise local distributions an possible datations in NorthItaly and Balkan to affirm something here – but L407 is only alocal developpement of L140 from P303, not a too special branch ofmarked ethnic originality -
and SILE, Helvarti were CELTS –Rhaeti cover 2 different realities, one I-Ean, either archaïcoccidental or cCltic too, one apparently close to Etruscans...

UltraViolence
12-03-15, 10:57
The reason G2a3b1 is considered Indo European is because it's found in India, the Kalash, and Iranian people, as well as throughout Europe. It may not be a big Haplogroup but that doesn't mean it's non Indo European. Its spread is clearly of Indo European origins.

G y-dna does not have any Indo-European origins, within the historical context


it's largely from early, pre-Indo European, Neolithic settlers in Europe.


this sub-clade is just one of the Neolithic groups who mixed with the later Indo-Europeans and migrated with them,


Maciamo clearly explained the reasons for it's geographic spread.

Sile
12-03-15, 11:17
G y-dna does not have any Indo-European origins, within the historical context


.

He was talking about the SNP, L497 of G , as per the paper it was created in Austria..............

Sile
12-03-15, 11:22
I have been surprised by this newthread
it is based upon only a supposedHaplogroups based itself upon an haplotype, found in aHallstatt site -
Hallstatt = place + period – here itwould be about 700 BC what is Hallstatt culture OK – but if Celtswere Y-R1b as a majority (a strong one) they could have integratedY-G2a ; that does not do Celts = Y-G2a ! - at the contrary,one could base an other theory upon this apparent local SNP and say,as it is very « highlander » regionally speaking it is THE non-I-Ean core ofRhaetic people having preceded Celts there! And if Rhaeti werelate neolithical people ? All the way all that is stillspeculation (I 'm not opposed by nature but I prefer doing bets uponmore data) - I don't speak here of the I-Ean craddle battle: no argument here to resolve this question!
I red some forumers considering Celtsappeared in History about the Iron Age in West-Central Europe – Itis true, the La Tène culture is linked to Celts –
Hallsttat = Celts ??? The wholeHallstatt culture ? Less sure !
And Celtic languages seem having beenspoken in Western Iberia before the Iron Age and the famous CentralIberia Celtiberians – Henri HUBERT was playing with the concept ofpossible Gaelic speakers in the Isles at the british Bell Beakers(Round Barrows) times, came from N-W Germany Rhine mouth -


to SILE : L247 is maybe born inAustria, maybe not, it is there it is the most frequent (but if I red well, one present in Baden culture? where in Baden ???)– but L247is the descendant of L140, « brother » to L694 and M278and found also in Northern and Western Europe – these three HaploGsare « sons » of P303, very common SNP present from Iberiato Iran if what I red was serious - what appears is it would bearrived from East across Continental Europe not across MediterraneaSea, so possible arrival among some I-Eans tribes from somewhere I donot take the risk to precise –
the L91 type and its « brother »M286 types are more certainly linked to Anatolia and MediterranianNeolithics moves – M406, « brother » to L141-1 itself« father » P303 is linked to Anatolia and Levant too butits high presence specifically in Italy could correspond to acolonization younger than Neolithic but distinct to the more widelyspred of L141-1 downtreams SNPs in Europe – M406 = Greeks ? Ora Chalcolithic (Copper) intrusion through North, from Balkans ?I lack precise local distributions an possible datations in NorthItaly and Balkan to affirm something here – but L407 is only alocal developpement of L140 from P303, not a too special branch ofmarked ethnic originality -
and SILE, Helvarti were CELTS –Rhaeti cover 2 different realities, one I-Ean, either archaïcoccidental or cCltic too, one apparently close to Etruscans...

what is L247?

I do not understand what you want to say.................basically as markers migrate they created mutations on their travels, these markers and where they are created are what people are trying to find......example, like mr. Hammer and his R1b theory........IIRC P312 in Hungaria, U106 in Harz mountains, U152 in middle rhine area ( all R1b ) etc

UltraViolence
12-03-15, 11:29
He was talking about the SNP, L497 of G , as per the paper it was created in Austria..............but Im sure many haplogroup sub-clades from historically pre-Indo European populations sprang up at a time when the carriers were living with or mixing with the people who spread IE languages/culture into Europe.


by that definition you can say just about all sub-clades from all European haplogroups have Indo-European origins if they originated from the Bronze Age era in Europe to the present.(?)



again, that makes no sense and its not accurate.

Maleth
12-03-15, 12:20
but Im sure many haplogroup sub-clades from historically pre-Indo European populations sprang up at a time when the carriers were living with or mixing with the people who spread IE languages/culture into Europe.


by that definition you can say just about all sub-clades from all European haplogroups have Indo-European origins if they originated from the Bronze Age era in Europe to the present.(?)



again, that makes no sense and its not accurate.

So Ultraviolence, in your opinion what would make sense and consider accurate?

MOESAN
12-03-15, 18:57
what is L247?

I do not understand what you want to say.................basically as markers migrate they created mutations on their travels, these markers and where they are created are what people are trying to find......example, like mr. Hammer and his R1b theory........IIRC P312 in Hungaria, U106 in Harz mountains, U152 in middle rhine area ( all R1b ) etc

Sorry I beg your pardon ! I wasspeaking about L497 (not the very older L247) the target of thisthread – my point was showing you it was seemingly not a SNP to farfrom « brothers » or « uncles » very commonin the whole Europe and farther -
No, « markers » don'tcreate mutations only as they travel – more often I think themutation occurs in a « mother » population numerousenough for that – when the bearers of the mutation, who are bydefinition at first grouped in a close region, are from a borderregion of the whole group and when they go away they give thismutated SNP a chance to get denser in the leaving group and even morenumerous than the upstream SNP if the new population created likethat know a demographic « boom » (it was the theory of« wave of advance » I suppose) -
genetics is dynamic : sometimeswhen I read some posts I've the feeling people believe an ethny = aSNP – I take Y-R1b-U152 : it is Celtic or Celtic-Italic (Iagree for the most) ; but some people forget
it is (was) going along with Y-R1b-P312(« father ») : but P312 is « father » totoo Y-R1b-L21 and other in Iberia, by instance : was a P312Iberian, Basque, Celt, Italic or... was it only confined in ansource region in central Europe ? No, we have P312 and P312 andother P312... here end there : the mutation is not« obligatory » -
But a genetic mutation is not by forceaccompagned by language mutation – what we can say is the departureof a small set of population can (not exactly at the same time) givebirth to a change in internal %s of SNPs AND a change in language(evolution, but surely with longer time) by geographic isolation ;CAN only – only long isolation can create new SNP far downstreamfrom the source -
so the Y-G2a3b1a2 L497 of Austria isnot a far downstream SNP compared to some other Y-G2a3b in Europe –it's very high internal incidence among cousins Y-G2a3 in Austriacould very well be a local drift (mountains) and not the proof of aspecific origin (in time or geography) – so a theory based upon anunic SNP found, correlated for time and place tho an ancient culturedoesn't prove a special link with this culture... it was only mypoint -
good forum

Aaron1981
12-03-15, 20:37
The Celts were G2a2b2a1b L497 ( Hallstatt Y-DNA from Mitterkirchen, Upper Austria 700BC)
10 marker matches from the region close to the Celtic ancient dna
2NWM5 Warren Zweisimmen, Switzerland Unknown Family Tree DNA 12 0
ABZX5 Beery Oberdiessbach, Switzerland G (tested) Family Tree DNA 12 0
NHMCH Willi Switzerland G2a3b1 (tested) Family Tree DNA 12 0
Z8UD6 Häfeli Switzerland Unknown Family Tree DNA 12 0
ZZQU9 Boyer Switzerland Unknown Family Tree DNA 12 0

Tabelle 2: Y-chromosomales DNA-Profile HÜ-I / 8
Tabelle 1: DNA-Profile HÜ-X / 1 und HÜ-I / 8
Objekt
06
Merkmal. DYS391 DYS389I DYS439 DYS389II DYS438 DYS437
HÜ-I / 8 10 12 11 29 10 16
Merkmal. DYS19 DYS392 DYS393 DYS390 DYS385
HÜ-I / 8 15 11 14 22 14 14

Ancient DNA from here
http://sonius.at/pdf/Sonius_07_WEB.pdf


Correction to your post.

THIS La Tene Celt is G2a2b, while the other 2 are R1b, most likely Z2105.

Robert6
12-03-15, 21:09
Correction to your post.

THIS La Tene Celt is G2a2b, while the other 2 are R1b, most likely Z2105.
One (Hallstatt) is G2a2b2a1b L497
One (La Tene) is R1b1a2a2 and probably R1b1a2a2c1 Z2105>>CTS7822>>CTS9219

Aberdeen
12-03-15, 21:33
but Im sure many haplogroup sub-clades from historically pre-Indo European populations sprang up at a time when the carriers were living with or mixing with the people who spread IE languages/culture into Europe.


by that definition you can say just about all sub-clades from all European haplogroups have Indo-European origins if they originated from the Bronze Age era in Europe to the present.(?)



again, that makes no sense and its not accurate.

I think people are suggesting that that subclade of G2 might be from the Caucasus, brought to Europe by IE people, instead of being part of the Neolithic G2 farmer group. However, there isn't yet any proof that any G2 migrated into Europe as part of the IE expansion, so I'm inclined to think that it's probably just an example of a person of Neolithic European descent who somehow became part of the Celtic group, just as it appears that some Mesolithic European hunter gatherer types from Y haplogroup I joined the Neolithic farmers.

Robert6
12-03-15, 21:52
I think people are suggesting that that subclade of G2 might be from the Caucasus, brought to Europe by IE people, instead of being part of the Neolithic G2 farmer group. However, there isn't yet any proof that any G2 migrated into Europe as part of the IE expansion, so I'm inclined to think that it's probably just an example of a person of Neolithic European descent who somehow became part of the Celtic group, just as it appears that some Mesolithic European hunter gatherer types from Y haplogroup I joined the Neolithic farmers.
From East Caucasus came the Satem group, the Celtic language have Iranian(Indo-Iranian, Yamna-LeilaTepe) adstratum

http://s017.radikal.ru/i409/1502/9d/f806bc8188b5.jpg
http://s017.radikal.ru/i409/1502/9d/f806bc8188b5.jpg

Sile
12-03-15, 22:00
From East Caucasus came the Satem group, the Celtic language have Iranian(Indo-Iranian, Yamna-LeilaTepe) adstratum

http://s017.radikal.ru/i409/1502/9d/f806bc8188b5.jpg
http://s017.radikal.ru/i409/1502/9d/f806bc8188b5.jpg

thats all fine...........
but the title of the thread is wrong, it should read -The G2-L497 is Raetic in origin .......as per my paper link

Robert6
12-03-15, 22:06
thats all fine...........
but the title of the thread is wrong, it should read -The G2-L497 is Raetic in origin .......as per my paper link
No,
the R1b-U152 is many in Raetic + Etrouscan territories, while the R1b-DF27 is Basqic
The R1b-Z2105 is EastCaucasian but some of them(in Yamna) are Indo-Iranized

Aberdeen
12-03-15, 22:06
From East Caucasus came the Satem group, the Celtic language have Iranian(Indo-Iranian, Yamna-LeilaTepe) adstratum

http://s017.radikal.ru/i409/1502/9d/f806bc8188b5.jpg
http://s017.radikal.ru/i409/1502/9d/f806bc8188b5.jpg

So what? Nobody is disputing the fact that the Celtic languages are IE. But if any one Y haplotype seems to be associated with the Celtic expansion in Europe, it's R1b. The fact that one G2 was found among early Celts in Europe doesn't prove that G2 was part of the mix before the IE folk arrived in Europe. That was probably just one G2 type who got absorbed by the R1b Celts, just as some I haplotype Mesolithic hunter gatherers in Europe got absorbed by Neolitic farmers from the Middle East after those farmers arrived in Europe.

Sile
12-03-15, 22:13
No,
the R1b-U152 is many in Raetic + Etrouscan territories, while the R1b-DF27 is Basqic
The R1b-Z2105 is EastCaucasian but some of them(in Yamna) are Indo-Iranized

yes, the Raetic where in the tyrol of the alps, the celts where not

Sile
12-03-15, 22:35
No,
the R1b-U152 is many in Raetic + Etrouscan territories, while the R1b-DF27 is Basqic
The R1b-Z2105 is EastCaucasian but some of them(in Yamna) are Indo-Iranized

Raetic are , apart from G2 clades, have R1b-L2 in majority of the R1b group, etruscans IIRC is mimimal in this clade

Robert6
12-03-15, 22:48
yes, the Raetic where in the tyrol of the alps, the celts where not

In Tyrol territories were resettled the Germanized Celtic tribe Boii (together with many G2-L497)


While the Romansh(Rhaeto-Romance) people that are living in Southeast Switzerland are believed to be direct descendants of the Raetia.

Sile
12-03-15, 22:54
In Tyrol territories were resettled the Germanized Celtic tribe Boii (together with many G2-L497)


While the Romansh(Rhaeto-Romance) people that are living in Southeast Switzerland are believed to be direct descendants of the Raetia.

wrong, the boii never settled in the alps

http://en.wikipedia.org/wiki/Boii

they where around emilia-romagna in italy though, but ended their travels in bohemia


raetic areas - all tyrol, all italian alps from swiss-austrian border to austrian-slovene border ( as per modern ).............

Robert6
12-03-15, 23:06
wrong, the boii never settled in the alps

http://en.wikipedia.org/wiki/Boii

they where around emilia-romagna in italy though, but ended their travels in bohemia


raetic areas - all tyrol, all italian alps from swiss-austrian border to austrian-slovene border ( as per modern ).............


Tyrol from the mid-6th century was resettled by Germanic Bavarii (http://en.wikipedia.org/wiki/Bavarii) tribes.

Bavarii or Baiuvarii was the term for the population of theBohemian Forest (http://en.wikipedia.org/wiki/Bohemian_Forest) area (which had been the territory of theBoii (http://en.wikipedia.org/wiki/Boii) during antiquity) from the 6th century; the name is Latinized from a possible self-designation *Baio-warioz, as it were "men of Bohemia (http://en.wikipedia.org/wiki/Bohemia)", where "Bohemia" (boio-hemum) in origin refers to the "home of the Boii (http://en.wikipedia.org/wiki/Boii)".

G2-L497 is also in Bohemia in Southern Poland in Slovakia in Hungaria

Sile
12-03-15, 23:52
Tyrol from the mid-6th century was resettled by Germanic Bavarii (http://en.wikipedia.org/wiki/Bavarii) tribes.

Bavarii or Baiuvarii was the term for the population of theBohemian Forest (http://en.wikipedia.org/wiki/Bohemian_Forest) area (which had been the territory of theBoii (http://en.wikipedia.org/wiki/Boii) during antiquity) from the 6th century; the name is Latinized from a possible self-designation *Baio-warioz, as it were "men of Bohemia (http://en.wikipedia.org/wiki/Bohemia)", where "Bohemia" (boio-hemum) in origin refers to the "home of the Boii (http://en.wikipedia.org/wiki/Boii)".

G2-L497 is also in Bohemia in Southern Poland in Slovakia in Hungaria



wrong

the Roman invasion of the raeti people started in 15BC..........they where the last area of the alps the roman invaded, if they where Celts or gallic the Romans would have attacked very early like they did in the po valleys and Gaul............the Romans never trusted the Gauls and celts

2nd error..........Bohemia is not in the alps............get a map and look

skaheen15
13-03-15, 00:58
So what? Nobody is disputing the fact that the Celtic languages are IE. But if any one Y haplotype seems to be associated with the Celtic expansion in Europe, it's R1b. The fact that one G2 was found among early Celts in Europe doesn't prove that G2 was part of the mix before the IE folk arrived in Europe. That was probably just one G2 type who got absorbed by the R1b Celts, just as some I haplotype Mesolithic hunter gatherers in Europe got absorbed by Neolitic farmers from the Middle East after those farmers arrived in Europe.

Yes, what he said.
Why is it such a shock to find some G2 in a Hallstatt site? The predominance of R1b among Celtic populations is about as certain as anything can be in this field. The Celts and their ancestors had been living in continental Europe for centuries at this point, naturally they would have assimilated some native lineages. Finding a G2 male with Hallstatt is worth noting, sure, but it's not a big surprise.

MOESAN
13-03-15, 01:10
From East Caucasus came the Satem group, the Celtic language have Iranian(Indo-Iranian, Yamna-LeilaTepe) adstratum

http://s017.radikal.ru/i409/1502/9d/f806bc8188b5.jpg
http://s017.radikal.ru/i409/1502/9d/f806bc8188b5.jpg

sorry where did you pick this liguistic well assured statement?
who edited this map with a 'gedrosia' already in N Persia ?

MOESAN
13-03-15, 01:19
Y-R1b-U152 in Rhaetic lands OK but when? today surely, but before ? an then in what valleys ? -
and Rhaetia was large enough: I red it had been settled by 2 populations (2 langu- celtic + etruscanlike )

MOESAN
13-03-15, 01:20
but I agree it's not surprising finding some Y-G2 among late Celts

Sile
13-03-15, 02:12
Y-R1b-U152 in Rhaetic lands OK but when? today surely, but before ? an then in what valleys ? -
and Rhaetia was large enough: I red it had been settled by 2 populations (2 langu- celtic + etruscanlike )

just remember, raetic, like etruscan, illyrian, thracian, angels, saxons , ligurians, iberian etc etc have an ethnicity...........celtic like slavic have no ethnicity, they only have language and culture

Robert6
13-03-15, 17:43
wrong

the Roman invasion of the raeti people started in 15BC..........they where the last area of the alps the roman invaded, if they where Celts or gallic the Romans would have attacked very early like they did in the po valleys and Gaul............the Romans never trusted the Gauls and celts

2nd error..........Bohemia is not in the alps............get a map and look

I know where is Bohemia, G2-L497 is also in Czech republic( in Bohemia)


Did you even read what I wrote?

Tyrol from the mid-6th century was resettled by Germanic Bavarii (http://en.wikipedia.org/wiki/Bavarii) tribes.

Bavarii or Baiuvarii was the term for the population of theBohemian Forest (http://en.wikipedia.org/wiki/Bohemian_Forest) area (which had been the territory of theBoii (http://en.wikipedia.org/wiki/Boii) during antiquity) from the 6th century; the name is Latinized from a possible self-designation *Baio-warioz, as it were "men of Bohemia (http://en.wikipedia.org/wiki/Bohemia)", where "Bohemia" (boio-hemum) in origin refers to the "home of the Boii (http://en.wikipedia.org/wiki/Boii)".

G2-L497 is also in Bohemia in Southern Poland in Slovakia in Hungaria

Robert6
13-03-15, 17:44
but I agree it's not surprising finding some Y-G2 among late Celts
Hallstatt are early Celts

Sile
13-03-15, 19:21
Hallstatt are early Celts

Hallstatt is invasion/migration of the first Celts from their original homleand of Central Germany. They formed a union with the Illyrians of Noricum . The Nori an Illyrian tribe , became celtinized and renamed Norici ....................Nori/norici created Noric steel.............when and where Noric steel first started is unknown. But Greek scholars state that noric steel swords came via the ister ( danube river ) through Euxine sea ( black sea ) to greek lands.

Robert6
14-03-15, 01:14
Hallstatt is invasion/migration of the first Celts from their original homleand of Central Germany. They formed a union with the Illyrians of Noricum . The Nori an Illyrian tribe , became celtinized and renamed Norici ....................Nori/norici created Noric steel.............when and where Noric steel first started is unknown. But Greek scholars state that noric steel swords came via the ister ( danube river ) through Euxine sea ( black sea ) to greek lands.
Early Celts(Hallstatt) is Iron age invasion, before the Iron age appeared in central Europe it was in Balkans and in Caucasus.
IE people in Balkans Caucasus and Iran learned how to work with Iron from Anatolians.


Also Cimmerians(Novocherkassk culture) in Early Iron age came to Steppes.
(Thraco-Cimmerian artifacts appear rather to spread from the Koban culture of the Caucasus and northern Georgia)


Iskuza the ancestors of Scythians came with Iron weapons to steppes from the borders of Urartu
first writing system of Scythians was the Luwian Hieroglyphics(Saqqez inscription, about Partitava, first Scythian King)


So not only the IE Balkanians had contacts with Anatolians but also Scythians and other Iranians had contacts with them.

MOESAN
14-03-15, 12:08
Hallstatt are early Celts

1- it's not sure Hallstatt was everywhere ethnic Celts + 2- the today consensus (I find reasonable) is Celts had already colonized West Europe before Iron - the Hallstatt period saw new types (metrics) about 25% among Tumuli people of S-Germany, surely an eastern influx (partial Illyrian imput?)-

all that is not new at all

MOESAN
14-03-15, 12:27
just remember, raetic, like etruscan, illyrian, thracian, angels, saxons , ligurians, iberian etc etc have an ethnicity...........celtic like slavic have no ethnicity, they only have language and culture


REMEMBER ?
all these tribes had a kind of ethnicity at some stage of their history after it became less clear for some of them.
Celts and Slavs as well as the others
historic Etruscans an ethnic homogene group? do you believe it?
and even well mixed, Slavs and Celts seem having left more genetic traces upon large spaces than did Etruscans in the small Toscana
you have personal ways to read history -
all that doesn't give any clue about Celts <> Y-G2a

MOESAN
14-03-15, 13:39
REMEMBER ?
all these tribes had a kind of ethnicity at some stage of their history after it became less clear for some of them.
Celts and Slavs as well as the others
historic Etruscans an ethnic homogene group? do you believe it?
and even well mixed, Slavs and Celts seem having left more genetic traces upon large spaces than did Etruscans in the small Toscana
you have personal ways to read history -
all that doesn't give any clue about Celts <> Y-G2a

I answer myself, I know I will be tolerant !

Iron Age tribes arrived (and let'sremember Iron appeared lately in a lot of places without too muchdemic moves) in an Europe which was already well populated(demographic boom and all directions moves during Urnfield Period ina lot of regions) – the elite tombs and strong hyerarchic soceityshow a relativey « wild » and « infantile »spirit of south-steppic form, but at La Tène it found again previoussituations more local and less hyerarchic – these new tribes orrather ne elites could not in Western Europe give way to the largeextension of all celtic languages nor even all italic ones – onlyit could permit (my modest hypothesis) some changes introduced inclose dialects like the Qw- >> P- shift...
maybe the Y-U152 in Croatia (apparentlyone of the highest internal % of U152 compared to all Y- R1b) datefrom Hallstatt time and would prove West-to-East movements showingHalsstatt gave BUT received too after a starting period ? A backmove of reinforced Celts before more eastern rovings?Speculation here...
some new people came and moved at Iron(we have traces of it, even physical remnants as in Denmark), butthey were in great part absorbed later - concerning genetic - even ifthey kept the leadership some time -

mihaitzateo
14-03-15, 16:25
G2-L497 is found only in Europe.
http://dienekes.blogspot.ro/2012/05/major-new-paper-on-y-chromosome.html

MOESAN
16-03-15, 00:19
G2-L497 is found only in Europe.
http://dienekes.blogspot.ro/2012/05/major-new-paper-on-y-chromosome.html

OK
and what conclusion...?

Melancon
24-03-15, 08:54
And your theory that Haplogroup G2a L497 is not Indo European is idiotic. Sorry.I did not claim any theories. Sorry.

Regio X
25-03-15, 18:33
Well, I have been following some good discussions about G haplogroup on Facebook and FTDNA. It seems that, in recent months, some progress has been made in conjectures concerning its evolution in time and space, thanks to a higher number of YDNA sequencing data, SNP testing etc. As reference, here is a very recent update from the expert R. Banks: sites.google.com/site/haplogroupgproject/-european-migrations

Update: Now he's suggesting that L497, which has the most G data now, is very European, and "also shows the major splitting from inside a small group also during the European Bronze Age". According to him, L497 may have come from Northern Caucasus with the Corded Ware culture or after it, both showing much "the same distribution today that was ascribed to the Celts when names were finally applied to the Bronze Age peoples". Still in his words, "the Celtic distribution and the Corded Ware people have heavy geographical overlaps", and L497 "did arrive on w. Mediterranean islands and western Scandinavia, but it is not clear if this was from the initial spread or secondary".

Regio X
26-03-15, 00:39
G2-L497 is found only in Europe.
(...)
"It seems that G-L497, which is one of the most 'European' of haplogroups, spread out from Western Anatolia (where it's found in small numbers) to the Danube Basin with the First Farmers, around 8400-7800 years ago.So far, the earliest branches of L497 are found in Italy and the Netherlands. The Anatolian and Aegean L497s are more 'derived' (further down the tree in G-Z725)."
(...)
Reference (remove blank spaces): w w w .marres.education/haplogroup_G.htm

Fluffy
28-05-15, 21:15
Well, I have been following some good discussions about G haplogroup on Facebook and FTDNA. It seems that, in recent months, some progress has been made in conjectures concerning its evolution in time and space, thanks to a higher number of YDNA sequencing data, SNP testing etc. As reference, here is a very recent update from the expert R. Banks: sites.google.com/site/haplogroupgproject/-european-migrations

Update: Now he's suggesting that L497, which has the most G data now, is very European, and "also shows the major splitting from inside a small group also during the European Bronze Age". According to him, L497 may have come from Northern Caucasus with the Corded Ware culture or after it, both showing much "the same distribution today that was ascribed to the Celts when names were finally applied to the Bronze Age peoples". Still in his words, "the Celtic distribution and the Corded Ware people have heavy geographical overlaps", and L497 "did arrive on w. Mediterranean islands and western Scandinavia, but it is not clear if this was from the initial spread or secondary".

There is a chance that G L497 came with the Corded Ware culture, as it was found in Poland at Wroclaw-Jagodno in a CW site.

Sloven-Vened
08-09-16, 10:29
Standard and very popular British and West theory about Celts is very nacionalistic. Popular theory about Celt is myth. Up to now archeologist do not found any some evidence of presence Celts in Hallstat culture.

And exist a lot of types of Hallstatt culture. They are different
Hallstatt culture in wikipedia (https://translate.google.com/translate?hl=sk&sl=ru&tl=en&u=https%3A%2F%2Fru.wikipedia.org%2Fwiki%2F%D0%93%D 0%B0%D0%BB%D1%8C%D1%88%D1%82%D0%B0%D1%82%D1%81%D0% BA%D0%B0%D1%8F_%D0%BA%D1%83%D0%BB%D1%8C%D1%82%D1%8 3%D1%80%D0%B0)

British Celts and "Hallstatt Celts" it is very different ethnic and genetic groups. Ethnicity of Hallstatt cultur is more nations, Slavic people too.

MOESAN
08-09-16, 13:57
Sloven-Vened, have you red the diverse precedent posts of this thread?

bicicleur
08-09-16, 14:32
Standard and very popular British and West theory about Celts is very nacionalistic. Popular theory about Celt is myth. Up to now archeologist do not found any some evidence of presence Celts in Hallstat culture.

And exist a lot of types of Hallstatt culture. They are different
Hallstatt culture in wikipedia (https://translate.google.com/translate?hl=sk&sl=ru&tl=en&u=https%3A%2F%2Fru.wikipedia.org%2Fwiki%2F%D0%93%D 0%B0%D0%BB%D1%8C%D1%88%D1%82%D0%B0%D1%82%D1%81%D0% BA%D0%B0%D1%8F_%D0%BA%D1%83%D0%BB%D1%8C%D1%82%D1%8 3%D1%80%D0%B0)

British Celts and "Hallstatt Celts" it is very different ethnic and genetic groups. Ethnicity of Hallstatt cultur is more nations, Slavic people too.

there are 2 groups of Celts : Halstatt and Atlantic Celts
IMO both descend from Csepl Bell Beaker

bicicleur
08-09-16, 14:38
G2a-L497 is way to old te be Celtic

https://www.yfull.com/tree/G-L497/

TMRCA is 7400 years, that is neolithic

maybe some subclades of L-497 were Celts, but they certainly were not the main branch

Sloven-Vened
08-09-16, 15:31
there are 2 groups of Celts : Halstatt and Atlantic Celts
IMO both descend from Csepl Bell Beaker
Post from administrator/autor of this site:
Bell Beakers were a multicultural phenomenon & trade network, not an ethnic culture
http://www.eupedia.com/forum/threads/29565-Bell-Beakers-were-a-multicultural-phenomenon-amp-trade-network-not-an-ethnic-culture

Bell Beaker archeological culture and Hallstatt archeological culture are 2 from most complicated and ambiguous cultures

Archeologists say, that do not exist relationship betwen Celts from Hallstatt culture and British / Irish people

This is link about Celts in middle Europa (Slovakia), in small Slovak village. It is scientific archeological publication. You can download PDF file
Prehistoric Settlement, Celts in middle Europa, Slovakia,
http://www.eupedia.com/forum/threads/32753-Prehistoric-Multicultural-Settlement-Celts-in-Slovakia-Bo%C5%A1%C3%A1ca-and-Lusatian-Culture

MOESAN
08-09-16, 19:09
OK All the archeologists share the same opinion: good new.

Sile
08-09-16, 20:28
G2a-L497 is way to old te be Celtic

https://www.yfull.com/tree/G-L497/

TMRCA is 7400 years, that is neolithic

maybe some subclades of L-497 were Celts, but they certainly were not the main branch

G-L497 according to the link below is 79.80% of a Tyrolese marker ( from western Austria )

http://www.blutspendezurich.ch/Media/File/Publikationen%202013/High%20resolution%20mapping%20of%20Y%20haplogroup% 20G(2).pdf

It is pre-celtic in origin

Sloven-Vened
08-09-16, 21:21
Haplogrup G are Arabs.
Celts are Arabs?
... Imigration of Arabs: now and in history: history repeats.
... and British and Irish Celtic nacionalism? ... human sacrifices?
https://en.wikipedia.org/wiki/Haplogroup_G_(Y-DNA)_by_country

Dr. Cyril Hroník is Slovakian scientist historian and linguistic expert with very rich and world academic career to "Celts" say: Ethymology of word "Celt" is "outlaw / bandit / gangster" (ethymology in dravidian tamil language. Tamil is the oldest language of world and Slovakian/Slavic launage has the most tamilic words. Tamilic words use other european languages too)
https://encrypted-tbn0.gstatic.com/images?q=tbn:ANd9GcRj22AyU_XJJn1FiiIkZJGSDPWT-1j8UoFpdaXRgFRRk_maipzO
Dr. Cyril Hroník

Angela
08-09-16, 21:49
Haplogrup G are Arabs.
Celts are Arabs
... Imigration of Arabs: now and in history: history repeats.
... and British and Irish Celtic nacionalism? ... human sacrifices?
https://en.wikipedia.org/wiki/Haplogroup_G_(Y-DNA)_by_country

Dr. Cyril Hroník is Slovakian historian and linguistic expert with very rich and world academic career to "Celts" say: Ethymology of word "Celt" is "outlaw / bandit / gangster"
https://encrypted-tbn0.gstatic.com/images?q=tbn:ANd9GcRj22AyU_XJJn1FiiIkZJGSDPWT-1j8UoFpdaXRgFRRk_maipzO
Dr. Cyril Hroník

Is this Slovakian humor? Arabs are G2?In what alternate universe?

Regio X
08-09-16, 21:58
G-L497 according to the link below is 79.80% of a Tyrolese marker ( from western Austria )

http://www.blutspendezurich.ch/Media/File/Publikationen%202013/High%20resolution%20mapping%20of%20Y%20haplogroup% 20G(2).pdf

It is pre-celtic in originSile, G-L497, virtually restricted to Europe (https://www.familytreedna.com/groups/g-ydna/about/), formed 10800 years ago, and the TMRCA is 7400 ybp. As bicicleur pointed out, Neolithic. It's so old and widespread in Europe that it must be related to the genesis of several people/cultures. The fact that most of G from Tyrol belong to this major clade (and particularly to G-L42) doesn't mean that it's necessarily "Tyrolean", imo.
Since we are talking on the Celts, it would make more sense consider subclades of G-L497 which are young and still widespread, like G-L42 (TMRCA 3700 ybp) and G-CTS4803 (3500 ybp), just for example. The hotspot of G-L42 is in Austria and Switzerland. It could be Rhaetian, but then who would have caused its dispersion? I don't know. Romans? Instead, it could be a minor clade of the Celts. One of the "suggestions" comes from skeleton HÜ-I/8 (http://www.researchgate.net/profile/Franz_Neuhuber/publication/264811880_Ancient_DNA_Y-chromosomal_DNA_Fingerprinting_in_Molecular_Archae ology_-_Paternal_Pedigrees_and_their_Potential_Geographic al_Correlates/links/53f225c70cf2f2c3e7fcc5c1.pdf) - 700 BC (La Tène). He was G, and likely G-L497, perhaps G-L42.

MOESAN
08-09-16, 22:41
I'm afraid we 'll be obliged to repeat the same things everytime a new forumer come in; no end; Y-G has its thread, and the simplest and sensible opinion is that it is of Neolithic origin; its position in refugium regions in Europe doesn't support a typical Celtic origin. What doesn' t exclude some late downstream SNPs moved along with diverse ethnies, across diverse lands from doverse points of horizon, so some of them among late Celtic groups. But the point is the link of Y-G1a with early Celts.
'Arab' is a relatively recent name maybe related only to Bedawins at first; are we naming WHGs Hunters-Gatherers "Spanyards" or "Swedes" or "Belgians"? But I think Angela has made the point concerning this misnaming and very distorded link Sloven-Vened did.

Regio X
09-09-16, 00:34
I'm afraid we 'll be obliged to repeat the same things everytime a new forumer come in; no end; Y-G has its threadhehe I don't understand. G-L497 is in the title of this thread. I don't even agree with it. Everybody know that first Celts were mainly R1b.


I'm afraid we 'll be obliged to repeat the same things everytime a new forumer come in; no end; Y-G has its thread, and the simplest and sensible opinion is that it is of Neolithic origin; its position in refugium regions in Europe doesn't support a typical Celtic origin. What doesn' t exclude some late downstream SNPs moved along with diverse ethnies, across diverse lands from doverse points of horizon, so some of them among late Celtic groups. But the point is the link of Y-G1a with early Celts.
'Arab' is a relatively recent name maybe related only to Bedawins at first; are we naming WHGs Hunters-Gatherers "Spanyards" or "Swedes" or "Belgians"? But I think Angela has made the point concerning this misnaming and very distorded link Sloven-Vened did.Maybe the subclade mentioned in the title of this thread has very little or nothing to do with Celts/Italics. I don't know. Those were just hypotheses based on few "signals".
Some people speculate that it's related to Etruscans. Maybe some subclade(s) are. I have no idea. Others (like G-CTS4803) are too widespread for that.

Not all G were confined in refugium regions. G-L497 is the main G subclade in Europe, and it's an example. In fact, it's the opposite: it's uncommon in these regions. Besides, there were more than one set of G, as Angela pointed out (see below).
See also these articles of Maciamo:
http://www.eupedia.com/genetics/italian_dna.shtml#bronze_iron_age
(...)
"The Roman form of G2a is almost certainly G2a3b1a and its two main subclades U1 and L497, whose distribution in Europe mirrors that of R1b-U152. These subclades make up 1.5% of Sardinian lineages, a proportion of 1/7 compared to R1b-U152."
(...)
- and http://www.eupedia.com/europe/Haplogroup_G2a_Y-DNA.shtml


The presence of this sub-clade among them obviously doesn't mean others were not, as was pointed out above, but it is interesting. In Boattini et al they showed five separate sets of G2a in Italy, with one arriving very late, and predominantly found in the north.

Alpenjager
09-09-16, 07:28
http://www.keltendorf-mitterkirchen.at/site/

https://de.wikipedia.org/wiki/Keltendorf_Mitterkirchen

bicicleur
09-09-16, 09:24
Post from administrator/autor of this site:
Bell Beakers were a multicultural phenomenon & trade network, not an ethnic culture
http://www.eupedia.com/forum/threads/29565-Bell-Beakers-were-a-multicultural-phenomenon-amp-trade-network-not-an-ethnic-culture

Bell Beaker archeological culture and Hallstatt archeological culture are 2 from most complicated and ambiguous cultures

Archeologists say, that do not exist relationship betwen Celts from Hallstatt culture and British / Irish people

This is link about Celts in middle Europa (Slovakia), in small Slovak village. It is scientific archeological publication. You can download PDF file
Prehistoric Settlement, Celts in middle Europa, Slovakia,
http://www.eupedia.com/forum/threads/32753-Prehistoric-Multicultural-Settlement-Celts-in-Slovakia-Bo%C5%A1%C3%A1ca-and-Lusatian-Culture

what is the definition of Celt?

tell me, why are Bell Beaker so predominantly R1b, more specific even R1b-L11 ?

Sloven-Vened
09-09-16, 13:33
what is the definition of Celt?

tell me, why are Bell Beaker so predominantly R1b, more specific even R1b-L11 ?
Post from administrator of this site:
Bell Beakers were a multicultural phenomenon & trade network, not an ethnic culture
http://www.eupedia.com/forum/threads/29565-Bell-Beakers-were-a-multicultural-phenomenon-amp-trade-network-not-an-ethnic-culture

The definition of Celt is vague for archeologists too.

MOESAN
09-09-16, 18:30
hehe I don't understand. G-L497 is in the title of this thread. I don't even agree with it. Everybody know that first Celts were mainly R1b.

Maybe the subclade mentioned in the title of this thread has very little or nothing to do with Celts/Italics. I don't know. Those were just hypotheses based on few "signals".
Some people speculate that it's related to Etruscans. Maybe some subclade(s) are. I have no idea. Others (like G-CTS4803) are too widespread for that.

Not all G were confined in refugium regions. G-L497 is the main G subclade in Europe, and it's an example. In fact, it's the opposite: it's uncommon in these regions. Besides, there were more than one set of G, as Angela pointed out (see below).
See also these articles of Maciamo:
http://www.eupedia.com/genetics/italian_dna.shtml#bronze_iron_age
(...)
"The Roman form of G2a is almost certainly G2a3b1a and its two main subclades U1 and L497, whose distribution in Europe mirrors that of R1b-U152. These subclades make up 1.5% of Sardinian lineages, a proportion of 1/7 compared to R1b-U152."
(...)
- and http://www.eupedia.com/europe/Haplogroup_G2a_Y-DNA.shtml

Sorry I answered under an upset condition (not very true indeed), and I wrote too quickly. I 'll try to make me clear:
- I wrote Y-G1a when I thought Y-G2a
- Y-G2a is in refugium areas in the core of the supposed cradle of Celts; it's sure that in Italy it's not so restricted in its distribution
- when we look at the hyperdominance of Y-G2a in Europe during Neolithic, and its rather restricted distribution today in the most of the areas we are obliged to consider it has not been the winner of Metal Ages Y-haplo's competition, in a time where the elites were male;
- surely there are diverse subligneages among Y-G2a and some of there, relatively recent compared to Neolithic, are more or less typical of some regions and of the today ethnicity of these regions, and surely they had different histories; but I find weird to link a statistically very minor male ligneage to the birth of an ethny (Celts here) when we see that the major male ligneages of this ethny or group of ethnies are all of the same not too ancient origin (Y-R1b-L51), origin common to other I-E speaking ethnies (Italic, Germanic, perhaps Lusitanian and Ligurian); I think you agree for this last point; If a find a specific subsubligneage of Y-E1b present solely among Irish eople, can I say: "Gaels or Western Celts were Y-E1b...x"? I know it's not your point, but Iwrite that to show I find useless to give life again to this thread linking G and Celts; a lot of things has been said in more than a thread about Y-G.
If people want to discuss Hallstatt, Atlantic and Celts identity (or lack of it) I should prefer they do that in a specific thread. But people are free, it was just my personal opinion.


You write:
Not all G were confined in refugium regions. G-L497 is the main G subclade in Europe, and it's an example. In fact, it's the opposite: it's uncommon in these regions. Besides, there were more than one set of G, as Angela pointed out (see below).
I answer: G-L497 is the main subclade among Y-G: it's very relative then; Y-G in Austria doesn't go very up the 11% if I don't mistake, locally, because the national mean would be 7-8%. the distribution of strongholds of Y-G is very spotty compared to other Y-haplos.
Where is Tyrol, or Switzerland? in plains? along big broad rivers, along coasts?
Y-G is common enough in Italy: Italy is a compartimented land; and Caucasus?
when a subclade makes say 75% or 7,5%, the absolute % is less than 7,5%, not 75%.
good evening by yhe way.

bicicleur
09-09-16, 18:48
Post from administrator of this site:
Bell Beakers were a multicultural phenomenon & trade network, not an ethnic culture
http://www.eupedia.com/forum/threads/29565-Bell-Beakers-were-a-multicultural-phenomenon-amp-trade-network-not-an-ethnic-culture

The definition of Celt is vague for archeologists too.

Celts are speakers of Celtic languages and Bell Beaker are almost exclusively R1b.

But we don't have Iberian BB DNA yet.

Regio X
10-09-16, 02:09
Sorry I answered under an upset condition (not very true indeed), and I wrote too quickly. I 'll try to make me clear:
- I wrote Y-G1a when I thought Y-G2a
- Y-G2a is in refugium areas in the core of the supposed cradle of Celts; it's sure that in Italy it's not so restricted in its distribution
- when we look at the hyperdominance of Y-G2a in Europe during Neolithic, and its rather restricted distribution today in the most of the areas we are obliged to consider it has not been the winner of Metal Ages Y-haplo's competition, in a time where the elites were male;
- surely there are diverse subligneages among Y-G2a and some of there, relatively recent compared to Neolithic, are more or less typical of some regions and of the today ethnicity of these regions, and surely they had different histories; but I find weird to link a statistically very minor male ligneage to the birth of an ethny (Celts here) when we see that the major male ligneages of this ethny or group of ethnies are all of the same not too ancient origin (Y-R1b-L51), origin common to other I-E speaking ethnies (Italic, Germanic, perhaps Lusitanian and Ligurian); I think you agree for this last point; If a find a specific subsubligneage of Y-E1b present solely among Irish eople, can I say: "Gaels or Western Celts were Y-E1b...x"? I know it's not your point, but Iwrite that to show I find useless to give life again to this thread linking G and Celts; a lot of things has been said in more than a thread about Y-G.
If people want to discuss Hallstatt, Atlantic and Celts identity (or lack of it) I should prefer they do that in a specific thread. But people are free, it was just my personal opinion.


You write:
Not all G were confined in refugium regions. G-L497 is the main G subclade in Europe, and it's an example. In fact, it's the opposite: it's uncommon in these regions. Besides, there were more than one set of G, as Angela pointed out (see below).
I answer: G-L497 is the main subclade among Y-G: it's very relative then; Y-G in Austria doesn't go very up the 11% if I don't mistake, locally, because the national mean would be 7-8%. the distribution of strongholds of Y-G is very spotty compared to other Y-haplos.
Where is Tyrol, or Switzerland? in plains? along big broad rivers, along coasts?
Y-G is common enough in Italy: Italy is a compartimented land; and Caucasus?
when a subclade makes say 75% or 7,5%, the absolute % is less than 7,5%, not 75%.
good evening by yhe way. No problem, Moesan.

- I reiterate that I don't agree with the statement in the title of the topic, which is its main idea after all. It makes no sense. You're probably right when implying that the reason of this thread is weak and that it shouldn't be stimulated. That said, I'll answer just your last post (also because I'm not a good writer in english, definitely; these texts take my time). :)
- I would say that Europe was dominated by "people" who carried certain haplogroups (correlation), not by haplogroups themselves, i.e., I'm not sure that these people were able to do it just because of specific mutations in the Y chromosome. Btw, given the birth rate among "native Europeans" (because of social evolution or whatever) and the immigration, could we roughly say that non-European haplogroups/subclades (which will become or will generate European haplogroups hereafter) just start to win the (natural) competiton in this new environment? What about America? Well, it could be a valid approach. Perhaps a subject for another thread... Anyway, I know what you mean, and you don't need to worry about that. No one here is saying that G2a (the mutations associated or, let's say, the "abstraction") won the (natural) competition. I wasn't discussing that. R1bs still are "the sherminators" (for those who watched American Pie). :)

https://pbs.twimg.com/media/B-f_JwUCQAAzFIw.jpg

Just for kidding and relax. ;-)

- My initial intervention was related to the comments of bicicleur and Sile. The pre-Celtic hypothesis doesn't confront necessarily what was being discussed, and the idea of a possible link between G subclades and the Celts/Italics, as that skeleton in Mitterkirchen supposedly suggests, isn't even mine (I saw it firstly in a page of none other than R. Banks, a G himself). It just makes sense to me so far as what it is, an hypothesis. But I confess that I was and I am a bit more interested here in the origin of the L497 subclades or in the L497 as a whole, whatever they are, than to the origin of Celts, and this fact would explain my focus. So, it would be better discussing the matter in another thread. I agree and apologize.
- Well, the birth of an ethnicity could be associated to several major haplogroups, especially in certain times and places. We see this all the time. Particularly, I would be interested to know about all the subclades involved in the process, major and minor, but of course it is not always possible, hence so many speculations, good or not. To make matters worse, it seems that "Celtic" is a very flexible term, and the discussions in threads like this confirm this notion. :)
- In your example, the presence itself of E1b...x wouldn't be enough to conclusions. Probably it would raise questions, and, associated to other evidences in an investigative work, it could occasionaly provide some answers about the subclade and/or the ethnicity in discussion. Major R1b subclades, for instance, also could raise deeper questions when they are in "wrong places", so to speak. Or even minor R1b subclades* (you would call it "R1b...x"), just like E1b...x. Why not? Anyway, this forum is a good place for these exercises.
*Btw, I wonder if there is a good map or percentages of R1b-L11 (xP312, xU106) or R1b-P312 (xL21, xU152, xDF27) in Europe!
- Again: while some G subclades are mainly in refugium areas, others are not (see Maciamo's articles). Regarding to distribution of L497, there are maps like Rootsi's and Berger's,but I'm affraid they are not so accurate. There is also a map in the L497 project in FTDNA, but some countries are sub represented, you must know. However, it's possible to notice in this sources a possible maritime dispersal and an important presence in some coastal areas, Rhone River and some islands.
- There would be places in Austrian Tyrol with more than 40% of G. As Sile said, most of these G are L497. On the other hand, the highest absolute % of L497 would be in Italy: almost 5% (likely more in North Italy). Still a little number, than what? In this line, we'll conclude that it isn't related to the birth of any non-ancient people, or at least that we can't speculate about it. It would be kind of a ghost. :)
Austrian as a whole has the same G % of Austrian Tyrol, Switzerland, South Germany: about 7/8%, which is not a negligible number.
G-L42 (TMRCA 3700 ybp), apparently more common in Switzerland and Austria than in other places, is present from South Europe (Kythira, for example) to North Europe. Late movements? Perhaps. At least in some cases. But the "Norwegian" subclade down L42, G-F1300.2 (https://sites.google.com/site/haplogroupgproject/g-f1300-2), for instance, is 3200 years old, and is so far restricted to Norway (coast). It doesn't seem to be related to recent movements, just like other subclades (old enough and restricted) down G-L42 and G-CTS4803. G-Z726 is also widespread in Europe, and it can be found even in Bureå, N. Sweden (Bure Kinship (https://en.wikipedia.org/wiki/Bure_kinship), G-Z726->G-CTS4803->G-S2808) - but probably it's a recent movement from South.
- Other subclades prevail in Caucasus. It has the highest G concentrations in the world (among Adyghe, about 50% are G; among Shapsugs, 80%; Abkhazians, about 50; and so on). G-U1 (the "Circassian (http://www.khazaria.com/genetics/circassians.html)") perhaps is the most important subclade in the region along with G-FGC595/Z6553 (old G-P16 (http://www.marres.education/alans.htm#dna)) (the "Ossetian/Alan (https://en.m.wikipedia.org/wiki/Alans#Genetics)").

Conclusion: Could G be related to the birth of Italics/Celts tribes as a minor but measurable clade? Given the circumstances, maybe. The answer "no" doesn't seem the best for me.

Sile
10-09-16, 02:31
Post from administrator of this site:
Bell Beakers were a multicultural phenomenon & trade network, not an ethnic culture
http://www.eupedia.com/forum/threads/29565-Bell-Beakers-were-a-multicultural-phenomenon-amp-trade-network-not-an-ethnic-culture

The definition of Celt is vague for archeologists too.

Correct, it was only a potting style learnt by the people there from others. People want to believe that H1 ( mtdna ) and R1b ( ydna ) brought it into the area.......but bothe markers where in BB lands 1000 years before the creation of this style of POTS

MOESAN
10-09-16, 18:57
@ RegioX
NO problem, all right.
But the very G2a-L497/L42 question could be discussed in a dedicated thread, if people want. No matter.

Concerning Celts, they are surely not come out from a magician hat. The linguistic existance is proven and they covered a huge territory. I personally doubt they were born only since the Iron Age and Hallstatt (I confirm old scholars estimated Hallstatt culture was finally shared by different ethnies, even if Celts were the principal one); I even wonder if a part of Hallstatt so called Celtic elite was not a non-celtic one at first, linguistically absorbed by celtophones a little in the way it occurred with Franks elite, at an higher level it's true. I even think proto-Celts were older than Urnfields which was also a multi-ethnic phenomenon, I think, at least in final phase; at La Tène time, the settlements seem returning to older conditions, more egalitarian. Henri Hubert think the Tumuli Culture of Southern Germany could have been already celtic or at least proto-celtic; He questioned the possibility that BBs derived culture of N-Germany-UK could have been already (proto)celtic, without being too affirmative; all the way, their cousins were already covering lots of lands in Western Europe at Bronze Age, as language differenciation seem proving it (Lusitanians, Ligurians, Italics). These people could have all of them known the BB cultural influence at some degree.
I wait news concerning Iberia BBs anDNA and Y-haplos, I'm longing to them! Maybe some surprises for the most of us whatever our biases or agenda or lack of them... I've nothing to add about BBs I said what I thought too often, more bets than science, as others (!) so...

Olympus Mons
11-09-16, 00:37
Correct, it was only a potting style learnt by the people there from others. People want to believe that H1 ( mtdna ) and R1b ( ydna ) brought it into the area.......but bothe markers where in BB lands 1000 years before the creation of this style of POTS

Man, I dont get it.
Bell beaker - No, BB were a very tight Genetic group sprung out of Iberia (and kept on being a tight group for all its BB period). This is what the best proxy for dna we have (see j. Desideri) Non metric dental traits. It also tells us that in bohemia BB toke CWC females and... dont know the rest, sorry.

Celts- In a less then a month old paper ANCIENT CELTS: MYTH, INVENTION OR REALITY? DENTAL AFFINITIES AMONG CONTINENTAL AND NON-CONTINENTAL CELTIC GROUPS from Mallory Anctil it looks like, yes, Celts were just a generalization of diferent (genetically) people learning to speak the same language and sharing traits.

Anyone wants to trash Non metric Dental traits as a proxy for Population DNA ?... bring it on!

Sile
11-09-16, 00:58
Man, I dont get it.
Bell beaker - No, BB were a very tight Genetic group sprung out of Iberia (and kept on being a tight group for all its BB period). This is what the best proxy for dna we have (see j. Desideri) Non metric dental traits. It also tells us that in bohemia BB toke CWC females and... dont know the rest, sorry.

Celts- In a less then a month old paper ANCIENT CELTS: MYTH, INVENTION OR REALITY? DENTAL AFFINITIES AMONG CONTINENTAL AND NON-CONTINENTAL CELTIC GROUPS from Mallory Anctil it looks like, yes, Celts were just a generalization of diferent (genetically) people learning to speak the same language and sharing traits.

Anyone wants to trash Non metric Dental traits as a proxy for Population DNA ?... bring it on!

And what, you are one that states that it was brought to central germany from Iberia by H1 ( mtdna ).............this old theory.
They found many H1 in central Germany in the eraly neolithic times, that's thousands of years before BB

Celts are ethnic proto-gallic people who began their existence in central and southern Germany

Olympus Mons
11-09-16, 01:26
And what, you are one that states that it was brought to central germany from Iberia by H1 ( mtdna ).............this old theory.
They found many H1 in central Germany in the eraly neolithic times, that's thousands of years before BB

Celts are ethnic proto-gallic people who began their existence in central and southern Germany

If I wanted to talk about Mtdna H1 I would have said so. No. What I am telling is that the second best thing about sampling ALL the bones/teeth that ever existed and sequence them (tens of thousands) for full genome (Not doable right now) is doing Nm dental traits studies. And the best ones were made, lo and behold to bell beakers and if I had to choose a few it would be the ones done by Geneva University by Desideri and Marie Besse. What does it say?

Bell beakers were made in Iberia by infusion of Iberia Late neolithic and Chalcolithic people. Then they move to rest of Europe had no local population contribution for a wide, wide range where they moved to. Not in South France, Switzerland, North Italy, or even the the Csepel group in HUngary. and never got any influx back from what is called the Eastern group. What is the eastern group? the only other place were BB toke local population contribution which was in bohemia (Czech) were they took CWC women (apparently loads of them). And from that point on there is no more Nm dental t studues as far as I know.

This is what we all know (or should). From this point on, everyone can drink the cool aid one likes and believe the fantasy he likes. Is just part of the game.

Olympus Mons
11-09-16, 01:32
Celts are ethnic proto-gallic people who began their existence in central and southern Germany

Sile, every day more so, Celts are just a derogatory term the ancient romans and greeks used to demeneour germanic barberic peoples outside their realms.
Read what I just linked regarding celts. Its really fresh off the printers...!

MOESAN
11-09-16, 19:10
If I wanted to talk about Mtdna H1 I would have said so. No. What I am telling is that the second best thing about sampling ALL the bones/teeth that ever existed and sequence them (tens of thousands) for full genome (Not doable right now) is doing Nm dental traits studies. And the best ones were made, lo and behold to bell beakers and if I had to choose a few it would be the ones done by Geneva University by Desideri and Marie Besse. What does it say?

Bell beakers were made in Iberia by infusion of Iberia Late neolithic and Chalcolithic people. Then they move to rest of Europe had no local population contribution for a wide, wide range where they moved to. Not in South France, Switzerland, North Italy, or even the the Csepel group in HUngary. and never got any influx back from what is called the Eastern group. What is the eastern group? the only other place were BB toke local population contribution which was in bohemia (Czech) were they took CWC women (apparently loads of them). And from that point on there is no more Nm dental t studues as far as I know.

This is what we all know (or should). From this point on, everyone can drink the cool aid one likes and believe the fantasy he likes. Is just part of the game.

« technical »point
I red Desideri'spapers. By the way she has a very good classical 'cromagnoid'face (not capelloid/brünnoid).
Some metrcis methodssupporters think non-metric traits in craniology are not the besttool to associate-discriminate pops because they (would) need verybig samples, being based on « familial » traits not toofrequent in any pop ; I don't know concerning dentalnon-metrics.
Desideri's work isprecise, but some of her conclusions are contradicted by her ownprecise analysis. Some comparisons separate local groups of BB, CWC,Unetice, LN... Other group the diverse localities result, giving theimpression of an homogenous pop when it is not exactly the case. Itdoesn't prevent to draw some conclusions.
Don't simplify toomuch the case :
- inCzechia/Bohemia, the males-females pooled localities show BB and CWCwere mingled together spite the global mean is not the very same.Only the Unetice sites are clearly aside spite not very far ; inHungary, the BB would show some affinity with southwesternersaccording to Desideri, and clearly are dsitnct from all the othercultures pops of Hungary ; in Spain, S-France and Switzerlandthere is not clear cut between BB and other (but she says otherauthors found metrical differences for some of the BB sites comparedto others.
- when males andfemales are pooled separatelyit's the BB males who seem at theintersection of BB females and CWC females ; the CWC males arenevertheless the closer to BB males spite they are a bit closer toUnetice : Unetice is very more homogenous, without greatdifferences between males and females, confirming the geographicalhomogeneity and perhaps a CWC males input.
- when comparingonly the BB sites, the Bohemia ones, spite separated, clustertogether, only one, not to far, cluster with ONE site in France ;as a whole N-Spain, S-France, Switzerland are spred and mingled, thelone site of Hungary among them.
With the reserves wecan do about sample and non-metric dental analysis, we can see theDesideri's result are not so straight away as someones could believe.She conclude herself there was seemingly a signal ofsouthwestern pops in Switzerland and Hungary, when at the opposite,Bohemia doesn't show an impressive arrival of newcomers fromSouthwest, what is not to say there was NO newcomer at first.


I think that in itsrelative heterogeneity (but less than other BBs region!!!) Bohemiadoesn't provide great difference between the BB and CWC pops shestudied, only some possible diversity in origin for some of thewomen.
What is sure is thatBB pops cannot be put all of them in the same bag. Concerning'mediter' tendancies, they existed in Switzerland and S-France longago before BB phenomenon.
I add theheterogeneity found among pops of N-Spain and S-France BB is – forme – linked more to the non-metric methodology used than to truegenetic differences.
I 'm still doubtfulabout a huge colonization from SW-Iberia at BB times, but I canmistake as everybody.

Sile
11-09-16, 20:11
If I wanted to talk about Mtdna H1 I would have said so. No. What I am telling is that the second best thing about sampling ALL the bones/teeth that ever existed and sequence them (tens of thousands) for full genome (Not doable right now) is doing Nm dental traits studies. And the best ones were made, lo and behold to bell beakers and if I had to choose a few it would be the ones done by Geneva University by Desideri and Marie Besse. What does it say?

Bell beakers were made in Iberia by infusion of Iberia Late neolithic and Chalcolithic people. Then they move to rest of Europe had no local population contribution for a wide, wide range where they moved to. Not in South France, Switzerland, North Italy, or even the the Csepel group in HUngary. and never got any influx back from what is called the Eastern group. What is the eastern group? the only other place were BB toke local population contribution which was in bohemia (Czech) were they took CWC women (apparently loads of them). And from that point on there is no more Nm dental t studues as far as I know.

This is what we all know (or should). From this point on, everyone can drink the cool aid one likes and believe the fantasy he likes. Is just part of the game.

So you are saying that you know of no marker that brought BB from Iberia to Germany.
If so, then the BB potters was just a style learnt by German BB from some Iberian BB traders.

so, you have either the gallics of central germany creating this BB
or
the ligurs of southern France creating this BB

I cannot see a BB created by proto-Portuguese and taking it firstly to brittany france to then go to central europe ...............was there a migration from iberia to germany?

The franco-cantbrian H1 mtdna is younger than what has been found in early neolithic central germany

Olympus Mons
11-09-16, 23:45
« technical »point
I red Desideri'spapers....
I 'm still doubtfulabout a huge colonization from SW-Iberia at BB times, but I canmistake as everybody.


Sile,
I only really trust Nonmetric dental because It really correlates well with dna. And Desideri means Nm dental trait and not crania/skeleton.

No, no. they are the experts and spend a lot of time in it. So add their work to what we already know. Things like oldest carbon & AMS dating for bell beaker in Zambujal Portugal, clear dating evolution on north spain, etc.
This is what she clearly says:

“the emergence of the Bell Beaker culture in the southern sphere resulted from the displacement of individuals from the Iberian Peninsula into Europe.
The biological impact was recorded to at least Switzerland, and possibly also to Hungary. Thus, the Bell Beakers – small groups of individuals equipped with their material culture and know-how – formed the basis for Bell Beaker diffusion in this region of
the phenomenon. - the situation in the eastern sphere is more complex.”

Then,

“The southern Bell Beakers are quite similar and the Swiss
populations can be strongly linked to their morphology. They form a highly uniform group. The
eastern Bell Beakers show a certain cohesion that seems, however, to have been less isolated”

Then,

“ Nevertheless, women - Corded Ware and Bell Beaker – were differentiated from the local populations, probably resulting from societies practicing exogamy”


So, anyone can play the story it really likes… but at this point in time facts are very clear. And those facts are in accordance with what we know.

MOESAN
15-09-16, 23:18
Sile,
I only really trust Nonmetric dental because It really correlates well with dna. And Desideri means Nm dental trait and not crania/skeleton.

No, no. they are the experts and spend a lot of time in it. So add their work to what we already know. Things like oldest carbon & AMS dating for bell beaker in Zambujal Portugal, clear dating evolution on north spain, etc.
This is what she clearly says:

“the emergence of the Bell Beaker culture in the southern sphere resulted from the displacement of individuals from the Iberian Peninsula into Europe.
The biological impact was recorded to at least Switzerland, and possibly also to Hungary. Thus, the Bell Beakers – small groups of individuals equipped with their material culture and know-how – formed the basis for Bell Beaker diffusion in this region of
the phenomenon. - the situation in the eastern sphere is more complex.”

Then,

“The southern Bell Beakers are quite similar and the Swiss
populations can be strongly linked to their morphology. They form a highly uniform group. The
eastern Bell Beakers show a certain cohesion that seems, however, to have been less isolated”

Then,

“ Nevertheless, women - Corded Ware and Bell Beaker – were differentiated from the local populations, probably resulting from societies practicing exogamy”


So, anyone can play the story it really likes… but at this point in time facts are very clear. And those facts are in accordance with what we know.


I red Desideri more than a time. I don't deny the input of southwestern females in BBs but the diverse BBs settlements did not show the same picture (read Desideri)one with another and the statement CWC and BB (Germany) practiced exogamy AT SOME LEVEL doesn't mean all their wives came FROM ELSEWHERE nor the exo wives came FROM FAR, nor these exo wives came FROM IBERIA or South, right? I 'm longing to more Megaliths auDNA too.
Wait and see for more data in other places (Netherlands, UK...) with other means than non-metric dental traits.

Olympus Mons
16-09-16, 11:44
I red Desideri more than a time. I don't deny the input of southwestern females in BBs but the diverse BBs settlements did not show the same picture (read Desideri)one with another and the statement CWC and BB (Germany) practiced exogamy AT SOME LEVEL doesn't mean all their wives came FROM ELSEWHERE nor the exo wives came FROM FAR, nor these exo wives came FROM IBERIA or South, right? I 'm longing to more Megaliths auDNA too.
Wait and see for more data in other places (Netherlands, UK...) with other means than non-metric dental traits.

Moesan,
Like I said, at the end of the day, anyone can take the cool aid it really likes. Thats what having so little data allows. Anyone lives in whatever fantasy land it chooses to. Including myself and you I suppose. Take, BB. Earlier dating, cranial and non-metric Dental traits, haplotype diversity of Mtdna H and replacement of female mtdna Sequencing BB dispersal from Iberia (even following their route within Iberia El portalon, etc), even the clear case that anthropological changes in a region being overall Demic diffusion not cultural (as is the new paradigm) etc, etc.. nope not enough. there is always room for doubt. by those standards, what anthropological assertion is a robust one? - None!
Again. Cool aid. Its just fine.

MOESAN
17-09-16, 14:00
Moesan,
Like I said, at the end of the day, anyone can take the cool aid it really likes. Thats what having so little data allows. Anyone lives in whatever fantasy land it chooses to. Including myself and you I suppose. Take, BB. Earlier dating, cranial and non-metric Dental traits, haplotype diversity of Mtdna H and replacement of female mtdna Sequencing BB dispersal from Iberia (even following their route within Iberia El portalon, etc), even the clear case that anthropological changes in a region being overall Demic diffusion not cultural (as is the new paradigm) etc, etc.. nope not enough. there is always room for doubt. by those standards, what anthropological assertion is a robust one? - None!
Again. Cool aid. Its just fine.

I like your form of humor!
If you are, I'm not living in any fantasy land. I'm rather measured in my affirmations and speak more about doubts that about certitudes. By the way I think that you and me are more here in a BBs trip than in a Celts and Y-G2a thread, I hope other will excuse both os us!
Reread Desideri if you rely on her. She concludes that Central Europe BBs - except Hungary: one site only - are distinct from other BBs ; the moves she supposes from Iberia to other lands concern France, Switzerland and Hungary. When we read in details, things are not so clear, far from it! One can conclude in a move of people (maybe females) from a western mediterranean region in these last regions, not North Central Europe. In which proportions? But our question is the Celts, Y-R1b, linked in some way to Germany and West-Central Europe BBs at this stage of our knowledge because we have NOTHING about Iberian BBs, neither for Y-haplos nor auDNA. Look at autosomes of North Central Europe BBs: not homogenous but all far from the Today Iberian situation and farther from the Chalco Iberians we have to date. I think it's very possible that supposed first BBs from S-Iberia colonized other lands, even some Germany ones, but I doubt they could have had a strong demographic input inheritedfrom on Iberian pops. What is not to say a pop very close to them has not participated in the demic building of Western Europe: the question is: in what proportions according to places and when? All the way I bet (not science, "bet") a lot of supposed BB issued mt-DNA was already present in Western Europe before the BBs daybreak. Maybe the same element? same people? But we speak of BBs and their later input, not of their possible ancestors.

Olympus Mons
17-09-16, 20:54
I like your form of humor!
If you are, I'm not living in any fantasy land. I'm rather measured in my affirmations and speak more about doubts that about certitudes. By the way I think that you and me are more here in a BBs trip than in a Celts and Y-G2a thread, I hope other will excuse both os us!
Reread Desideri if you rely on her. She concludes that Central Europe BBs - except Hungary: one site only - are distinct from other BBs ; the moves she supposes from Iberia to other lands concern France, Switzerland and Hungary. .... of Western Europe: the question is: in what proportions according to places and when? All the way I bet (not science, "bet") a lot of supposed BB issued mt-DNA was already present in Western Europe before the BBs daybreak. Maybe the same element? same people? But we speak of BBs and their later input, not of their possible ancestors.


Moesan,
Lets get the record straight (at least my straight, dont know yours). Some that might read us here surely get confused.
a. I dont care about Desideri. I care about NonMetric dental traits studies. Because craniometrics can indeed be influence by enviromental changes but not really Nm Dental traits. these are a pretty good proxy for Genetics. And studies apply to vast amount of samples and lots of different places. - And do not cost a million dollars on a fancy lab in Harvard run by a guy called Reich.

b. You seem to think that Central European beakers were "very" important. That bohemia group that Desideri talks about. Why do you think so? Actually and in truth they are only Bell beakers ISH. I called it Half breeds. And, most important and first of all, you forget the first rule while looking at, any, BB phenomenon - The further away from the ocean the more sparse and isolated and not that populated the bell beaker settlement is. so, Central European BB... is nothing. its bullshit in the big picture. Now BBish and CWC influencing Unetice and having impact that is a different story.

C. Yes, BB Iberia (which we actually have no genome from) was BB stock that travelled to South France, Switzerland, North Italy, etc. And by cultural similitude one can safely say most Atlantic facade BB settlements. That can be fairly accepted, and that is what desideri states. dont confuse the issue. We dont know what happen from the Elbe up, and baltic BB, etc. Maybe just the eastern BB and not at all the Iberia BB had impact on the north Europe. But in truth, by end 3rd millennia we should start to call them something else and just state that BB were the ones that come out of Iberia and lasted for a millennia.

d. Celtic. again Nm dental t. Mallory Anctil just a couple weeks ago. La tene, halstaatt and british Celtic: Not the same people. From there all is valid.

MOESAN
18-09-16, 13:19
Moesan,
Lets get the record straight (at least my straight, dont know yours). Some that might read us here surely get confused.
a. I dont care about Desideri. I care about NonMetric dental traits studies. ... d. Celtic. again Nm dental t. Mallory Anctil just a couple weeks ago. La tene, halstaatt and british Celtic: Not the same people. From there all is valid.
My last post concerning BBs in this thread. I'm ready to keep on in a specific BBs thread because we're invading the present thread in some way. I think you don't get my points. Concerning dental traits, could you let me know the diverse studies you have at hand for I can make my opinion. Thanks beforehand.

Olympus Mons
19-09-16, 14:02
My last post concerning BBs in this thread. I'm ready to keep on in a specific BBs thread because we're invading the present thread in some way. I think you don't get my points. Concerning dental traits, could you let me know the diverse studies you have at hand for I can make my opinion. Thanks beforehand.

Yes, Make sense.
Regarding Nmetric Dental, there are a lot that one must really read. Like Mallory Anctil about celts and one of the best "NONMETRIC DENTAL TRAIT DISTRIBUTION IN THE NEOLITHIC POPULATIONS OF SOUTHWESTERN SIBERIA" from A.V. Zubova.

This latest if shows how Karelia (8000bc) and Latvia Mesolithic very specific dental traits, suddenly are found as far on the other side of the urals to Samara, in Vengerovo-2a, (close to Urals in the baraba forest) in a specific population that was different from the Afontova gora and different from Populations from Baikal.
Actually is seen in later periods in south turkeministan near lake Mergan.

Its really on par with the latest findings and models .

I may open a thread on it... No more of off topic here. You are right.

MOESAN
22-09-16, 10:37
@Olympus Mons
Thanks! I red the paper of Mallory Anctil; interesting to show differences (as all Nmetric teeth surveys) but not to weight them and to provide clues concerning admixture and interpops exchanges; in my opinion it's the whole question in discrete traits without huge and numerous multi-places samples; here only 4 very remote sites or pooled close sites)

Olympus Mons
22-09-16, 15:49
@Olympus Mons
.... here only 4 very remote sites or pooled close sites)

Yes. But 4 remote sites and lots and lots of samples. These days we make huge amounts of inferences based on a SINGLE Adna sample, that for all I know could even been the son of a girl snatched 4,000 miles away.

Nm dental traits are a good proxy. actually very good. for instance see these (but there are others) that show how accurate it is at differentiating populations. http://www.ncbi.nlm.nih.gov/pubmed/25711463

MOESAN
22-09-16, 19:27
@OlympusMOns
Thanks I 'll read this when possible.
Concerning the "lots and lots" of sample I red in M. Anctil:
Yorksh: 31 - Switz: 33 - Hallst: 30 - Ital: 31 - it's not so huge I think.
He avowed familial proximity of close tombs (they are removed in auDNA studies) -
+ "... Fixed or largely invariant traits are removed as well, because they provide no useful information for identifying differences among samples, and can result in negative MMD (Mean Measure Divergence). The later later is a statistical artefact that has no "biological meaning" (citation)..."]: so this kind of study exagerates the differences at the cost of ressemblances, so can perturb (for me) the weighting and understanding of differences. Not to say these studies are of no worth; otherwise I would not read them.

I never take seriously a state made upon short numbers in haplo's states; here I agree with you. In autosomal DNA we don't need too huge samples at the contrary - except the elite DNA can be very unstable from generation to generation in old times.

MOESAN
24-09-16, 18:24
Man, I dont get it.
Bell beaker - No, BB were a very tight Genetic group sprung out of Iberia (and kept on being a tight group for all its BB period). This is what the best proxy for dna we have (see j. Desideri) Non metric dental traits. It also tells us that in bohemia BB toke CWC females and... dont know the rest, sorry.

Celts- In a less then a month old paper ANCIENT CELTS: MYTH, INVENTION OR REALITY? DENTAL AFFINITIES AMONG CONTINENTAL AND NON-CONTINENTAL CELTIC GROUPS from Mallory Anctil it looks like, yes, Celts were just a generalization of diferent (genetically) people learning to speak the same language and sharing traits.

Anyone wants to trash Non metric Dental traits as a proxy for Population DNA ?... bring it on!

No fighting here.
Just to say that the term "different pops" is not too precise: "different" like purely unrelated one to another, or distinct substrata mixed with a more or less homogenous NEWpop (the dominant one, bringing with its culture and power? Even metric old surveys and Ancients descriptions told us the Celtic lands were not settled by indentical pops. So here, metric and non-metric doesn't contradict one another. The question is: has it been moves or almost no moves and if moves, in what proportions? metrics about Celtic (surely ELITES) of Iron Age in West showed some degree of heterogeneity but also some COMMON elements everytime everywhere in the IA Celtic mixt, from Germany-France to Ireland. It seems that in the Isles, the Bronze Age pops were stayed on the the mix pre-Round Barrows/Round-Barrows with EVEN THERE some variations in the mixt. I think we lack still more geographically spred data in dental non-metrics. In the survey alleged we have only 3 supposed Celtic places. BTW I noticed they said the Italian IA sample (Villanovian of South-Italy?) was the most remote opposed to the 3 others.
Wording is important. If we rely on the conclusions of the Armenian study of dental NM traits about Armenia, Caucasus and Steppes, we could think as easily all these Steppic pops were quasi identical to Armenians (but Armenians were distinct within them!); I'm not ready to swallow these generalisations, or I 'll need some liquid (not water!). All the way, I thank you for the informations you posted to me.
Just to say I admit the validity of some conclusions but they don't answer all my questions.