View Full Version : Introduction new member (Y-DNA: J-L283)
Hi all,
I just wanted to introduce myself since I am a new member of this forum.
I am Romanian, born in Bucharest and I find it fascinating to learn more about my ancestry.
As far as I know all my close relatives (up until grand-grand parents) were born in what was once called Wallachia - most of them in Moroeni - Targoviste - Ploiesti - Bucharest area. Via 23andme I have learned that my Y-DNA halplogroup is J2 (M172) > J2b (M102) > J2b2 (Z1825) > J-M241 > J-L283 and my mtDNA is J1. I just don't know how to interpret all these results. I would be very grateful if you could help a bit out here. I will be very happy to share my ancestry details on specific websites dedicated to DNA studies and to deepen my DNA search - I mean going to search further via subclades. However I don't know quite how and where to start. All ideas or suggestions are welcome.
Thank you in advance!
Hi all,
I just wanted to introduce myself since I am a new member of this forum.
I am Romanian, born in Bucharest and I find it fascinating to learn more about my ancestry.
As far as I know all my close relatives (up until grand-grand parents) were born in what was once called Wallachia - most of them in Moroeni - Targoviste - Ploiesti - Bucharest area. Via 23andme I have learned that my Y-DNA halplogroup is J2 (M172) > J2b (M102) > J2b2 (Z1825) > J-M241 > J-L283 and my mtDNA is J1. I just don't know how to interpret all these results. I would be very grateful if you could help a bit out here. I will be very happy to share my ancestry details on specific websites dedicated to DNA studies and to deepen my DNA search - I mean going to search further via subclades. However I don't know quite how and where to start. All ideas or suggestions are welcome.
Thank you in advance!
Welcome Telsh,
from this page you can find out about the theories, the history and the spread of paternal and maternal haplogroups:
https://www.eupedia.com/europe/origins_haplogroups_europe.shtml
If you performed the test with 23andMe you should be able to download your raw data (it's a file that shows the sequence of your genome) and load them on some online calculators like those of Gedmatch to check your autosomal and see if it's in line with the average of your population or if in your family history there are more "exotic" influences and external contributions:
https://www.gedmatch.com/login1.php
AAi is part of Asad Abbas & Co. (Chartered Accountants), an accounting, tax and business consultancy firm in UAE and a member of PrimeGlobal International, one of the 5 largest associations of independent accounting firms in the world. Asad Abbas & Co. (Chartered Accountants) provides cost-effective and efficient professional services to the business community.
Hi Stuvanè and thanks a lot for your reply.
I have managed to upload my genome on gedmatch and familytreedna.com but further than that I don't know what to do next. I believe I should purchase additional test products according to my Y-DNA? Do you have any other suggestions - other resources I might use or which tests should I get?
ahh 23andme, nevermind, no comment.
Hi all,
I just wanted to introduce myself since I am a new member of this forum.
I am Romanian, born in Bucharest and I find it fascinating to learn more about my ancestry.
As far as I know all my close relatives (up until grand-grand parents) were born in what was once called Wallachia - most of them in Moroeni - Targoviste - Ploiesti - Bucharest area. Via 23andme I have learned that my Y-DNA halplogroup is J2 (M172) > J2b (M102) > J2b2 (Z1825) > J-M241 > J-L283 and my mtDNA is J1. I just don't know how to interpret all these results. I would be very grateful if you could help a bit out here. I will be very happy to share my ancestry details on specific websites dedicated to DNA studies and to deepen my DNA search - I mean going to search further via subclades. However I don't know quite how and where to start. All ideas or suggestions are welcome.
Thank you in advance!
The most knowledgeable person on J2b-L283 is Trojet. He is an admin of the J2b project at FTDNA.
From my understanding, without a Y37 or bigY test we can’t know for certain where you paternal ancestor is derived. However,J2b-L283 was found in the remains of a Proto-Illyrian in Dalmatia. It is one of the most common lineages in Albanians, especially Albanian highlanders(Ghegs).
Considering the migration of Albanians to Romania and especially Bucharest, I would say your paternal ancestor was likely one of many Orthodox Christians Albanians that migrated there.
The best way to be certain is to take that test. This way, if you have Albanian matches in recent history it would be a guarantee. If your matches with Albanians go back to classical history, then it could have been a Illyrian or Daco-Thracian that splintered off.
Hi Stuvanè and thanks a lot for your reply.
I have managed to upload my genome on gedmatch and familytreedna.com but further than that I don't know what to do next. I believe I should purchase additional test products according to my Y-DNA? Do you have any other suggestions - other resources I might use or which tests should I get?
Hi Telsh.
Dibran preceded me and gave you more than useful information. It depends on how much you want to go deeper into your haplogroup's subcladic investigation. In your case you should consider yourself lucky enough, because 23andMe was quite detailed in providing you with the specific clade of J-L283 (in my case they were much less specific).
If you are very curious here you can already check how it is divided and is currently widespread
https://www.yfull.com/tree/J-L283/
https://www.familytreedna.com/public/y-dna-haplotree/J;name=J-L283
If you wanted to go deeper into a specific subclade of your paternal haplogroup you could also test yourself with the YSEQ kits, then compare the data obtained with the databases and maps provided by various sites like those of Family Tree Dna.
In any case, when these researches are generally carried out - if I were you - I would take small steps, especially because everything on our haplogroup was said and the opposite of everything, and apart from some fairly firm points (as would seem to be its archaic approximate origin in the area of the Caucasus / northern Mesopotamia and with J2b successfully established mainly in the Balkan territories) the history of its dispersion is not yet linear and is probably attributable to several events that cannot always be correlated with each other.
The most knowledgeable person on J2b-L283 is Trojet. He is an admin of the J2b project at FTDNA. ... Y37 or bigY ...
... YSEQ kits ...
Hi guys,
First of all I would like to thank you for all the information and recommendations provided. I really appreciate this.
I am definitely going to go deeper into my haplogroup's subcladic investigation, but I still have to decide which way to go first.
At this point I have decided not to take the big Y, I would like first to go for one of the following 2:
- YSEQ kit for L283
- FTDNA Y37 or Y25 (don't really understand the difference here, I see that it only differs in terms of number of generations in Y25 favour).
Which one from above do you think would be the best choice in my case - given the fact that 23andme already provided me with this J2b-L283 clade. Do you think the YSEQ kit for L283 would be enough at this moment or should I go for Y37 or Y25 instead?
Thanks again and have a fine weekend!
Hi guys,
First of all I would like to thank you for all the information and recommendations provided. I really appreciate this.
I am definitely going to go deeper into my haplogroup's subcladic investigation, but I still have to decide which way to go first.
At this point I have decided not to take the big Y, I would like first to go for one of the following 2:
- YSEQ kit for L283
- FTDNA Y37 or Y25 (don't really understand the difference here, I see that it only differs in terms of number of generations in Y25 favour).
Which one from above do you think would be the best choice in my case - given the fact that 23andme already provided me with this J2b-L283 clade. Do you think the YSEQ kit for L283 would be enough at this moment or should I go for Y37 or Y25 instead?
Thanks again and have a fine weekend!
Hi and congrats on your result. As already mentioned, J-L283 is ~5400 year old mutation, and it has many subsequent younger subclades. Unfortunately, 23andMe doesn't test for its subclades, except Z631 in some cases. So if you are classified as J-L283, odds are you have tested L283+ Z631- and belong somewhere in between L283 and Z631: https://www.yfull.com/tree/J-L283/
For deeper testing, Big Y-700 from FamilyTreeDNA or another NGS test, is always the best option.
Understandingly, this is out of the question for many due to the price. From the above-mentioned options, both FTDNA Y37 or YSEQ Panel would be fine. However, since you already know you are J-L283, I would suggest the J2b-M12 Panel from YSEQ which will test for pretty much all subclades you see on YFull, which to date have been discovered by BigY or other NGS tests. The YSEQ J2b-M12 Panel can be ordered by following this link: https://www.yseq.net/product_info.php?cPath=27&products_id=45234
Dreptul Valah
20-07-19, 19:43
Moroieni are a branch of Mocani,the Transylvanian shepherds;how come both J2b2 and E-V13(see also Martinez-Cruz) peak in Transylvania, it really makes no sense to me.
While Wallachia and Moldavia is high on I2a,the presence of this hg in Herzegovina and Dalmatia seems to indicate an early Byzantine affiliation,expansion.
https://j2-m172.info/2015/10/j2b2a1-l283-origins-by-diversity-and-subgroups-focus-jewish-lineages/
EDIT
For the very early distribution of I2a in Romania,see the Moravian Vlach lineages.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3131682/
Hi and congrats on your result. As already mentioned, J-L283 is ~5400 year old mutation, and it has many subsequent younger subclades (...) However, since you already know you are J-L283, I would suggest the J2b-M12 Panel from YSEQ which will test for pretty much all subclades you see on YFull, which to date have been discovered by BigY or other NGS tests. The YSEQ J2b-M12
Hi Trojet,
Thanks a lot for your input. I have decided to go for the YSEQ J2b-M12 test.
I will update here whatever I get. I'm really curious :)
Thanks all for your support.
Moroieni are a branch of Mocani,the Transylvanian shepherds;how come both J2b2 and E-V13(see also Martinez-Cruz) peak in Transylvania, it really makes no sense to me.
While Wallachia and Moldavia is high on I2a,the presence of this hg in Herzegovina and Dalmatia seems to indicate an early Byzantine affiliation
Hi Dreptul Valah,
Actually it's Moroeni, not Moroieni. Dâmboviţa county.
I am also a member of maternal haplogroup J1, more specifically J1c2b, a North Sea and British Isles subclade. You could be either J1b, which was brought to Europe by Indo-European invaders, or J1c, which originated in the Balkans or northwest Anatolia and was one of the main subclades of the Neolithic Farmers before it was taken up by Indo-European invaders as well.
Dreptul Valah
20-07-19, 20:01
Hi Dreptul Valah,
Actually it's Moroeni, not Moroieni. Dâmboviţa county.
Triphtongs are one of our strenghts,oie is quite oftenly simplified (reduced)to oe,can be found in Balkan Latin.
https://en.m.wikipedia.org/wiki/Tetovo
Dreptul Valah
20-07-19, 21:50
EDIT
Interesting,it seems that most of the Balkanites brought by the Phanariotes were settled/rewarded by the Habsburgs into their territories, with fiscal facilities, in the 18th c.,unfortunately the situation is presented exactly the opposite;that's one possible explanation.
The information comes exactly from their Hungarian friends.
http://mek.oszk.hu/03400/03407/html/280.html
I am also a member of maternal haplogroup J1, more specifically J1c2b, a North Sea and British Isles subclade. You could be either J1b, which was brought to Europe by Indo-European invaders, or J1c, which originated in the Balkans or northwest Anatolia and was one of the main subclades of the Neolithic Farmers before it was taken up by Indo-European invaders as well.
My MtDNA haplogroup has been classified as J1 but my brother got J1c. And we have the same mother.
It's a bit funny because his Y-DNA haplogroup according to 23andMe was "only" J-M241, whereas mine is J-L283.
Guido Anselmi
21-07-19, 10:38
Hi Dreptul Valah,
Actually it's Moroeni, not Moroieni. Dâmboviţa county.
Over at 23andMe Romania comes in 3rd place for me in Ancestry, actually ahead of Serbia which comes 4th. I don't know if this is due to 23andMe customer selection bias (more Romanians than Serbians in their overall customer base) but it is interesting, especially as Dambovita County pops up as number one for me in Romania. Yes, it is autosomal, but it's pretty interesting that both you and I are J-L283. Trojet has me predicted as J-Z631 over at FTNDA.com so I'm looking forward to what your result will be.
https://i.postimg.cc/R0HQp4FG/romanian.jpg
I am left wondering if there was a migration from Southwestern, Southern Balkans into this central portion of Romania some time in the distant past. Aromanians? I get connections both autosomally and paternally with present-day Northern Greece, parts of Macedonia and Albania.
I assume that the Moro in Moroeni refers to the colour black. Would this be correct? Black Village, or something along those lines? Moro, Morovlasi, Morlaci, Morlachs........just off of the top of my head as I don't know how old the toponym Moroeni is.
brittney.smith
21-07-19, 10:53
I have managed to upload my genome on gedmatch and familytreedna.com but further than that I don't know what to do next. I believe I should purchase additional test products according to my Y-DNA? Do you have any other suggestions - other resources I might use or which tests should I get?
brittney.smith
21-07-19, 10:56
hi, Thanks for introducing ,,, i am brittney, new member of this forum. i love to explore biology terms and also love travelling to whole world.
Over at 23andMe (...) I assume that the Moro in Moroeni refers to the colour black. Would this be correct? Black Village, or something along those lines? Moro, Morovlasi, Morlaci, Morlachs........just off of the top of my head as I don't know how old the toponym Moroeni is.
I'm also very curious about what the next test will reveal.
While as far as I know my grandfather who was born in Moroeni had no relatives of other ethnicity up until his own grandparents (at least not that he would be aware of), according to my 23andMe ancestry composition, Argeș county pops as number one for me, which is kind of surprising at this point of investigation. We'll see what the next results bring. Anyway I will post them here.
Regarding the etymology of the word Moroeni, I really have no idea, maybe a linguist could help here. Here's what I personally found:
"The patronym Moroianu derives from a nickname by which the inhabitants of the hill areas of Muntenia called the Romanian migrant shepherds from Bran. During the descent of the sheep, in late autumn, to their wintering places (in Romanian = “iernat”) in Balta Dunării, Dobrogea/Dobrudja and Bugeac/Budjak, they looked like frightening spirits to the locals (in Romanian = moroi), appearing into the light and heavy rain in the misty weather (in Romanian = “ploaie mocănească”). Derived from this nickname, the place-name Moroieni appears in the Subcarpathians, in Dâmbovița County, and the settlement was probably founded by the mentioned shepherds."
The most knowledgeable person on J2b-L283 is Trojet. He is an admin of the J2b project at FTDNA.
From my understanding, without a Y37 or bigY test we can’t know for certain where you paternal ancestor is derived. However,J2b-L283 was found in the remains of a Proto-Illyrian in Dalmatia. It is one of the most common lineages in Albanians, especially Albanian highlanders(Ghegs).
Considering the migration of Albanians to Romania and especially Bucharest, I would say your paternal ancestor was likely one of many Orthodox Christians Albanians that migrated there.
The best way to be certain is to take that test. This way, if you have Albanian matches in recent history it would be a guarantee. If your matches with Albanians go back to classical history, then it could have been a Illyrian or Daco-Thracian that splintered off.
Albanian orthodox who migrated to romania? Interesting story, where did you get this? I would loke to read more about this.
My paternal grandma is Aromanian (Çoban), she told me that according to the chrnoicles of my ancestors from her side they were shepherds from Tetovo and Rugovo that came 200 years ago from makedonia to albania, in particular Divjake/Lushnje area + in korça, elbasan and tirana where it's full of them.
Surname of her family Gorrea, is this any vlach/romanian surname or what? + another side pf her family has surname Rrudha/Rrudho.
Efrain Garve
26-07-19, 12:25
Hi everyone!
I am new here too :)
Albanian orthodox who migrated to romania? Interesting story, where did you get this? I would loke to read more about this.
My paternal grandma is Aromanian (Çoban), she told me that according to the chrnoicles of my ancestors from her side they were shepherds from Tetovo and Rugovo that came 200 years ago from makedonia to albania, in particular Divjake/Lushnje area + in korça, elbasan and tirana where it's full of them.
Surname of her family Gorrea, is this any vlach/romanian surname or what? + another side pf her family has surname Rrudha/Rrudho.
Its pretty well known from what I can tell.
https://en.m.wikipedia.org/wiki/Albanians_of_Romania
JajarBingan
01-08-19, 16:27
Albanian orthodox who migrated to romania? Interesting story, where did you get this? I would loke to read more about this.
My paternal grandma is Aromanian (Çoban), she told me that according to the chrnoicles of my ancestors from her side they were shepherds from Tetovo and Rugovo that came 200 years ago from makedonia to albania, in particular Divjake/Lushnje area + in korça, elbasan and tirana where it's full of them.
Surname of her family Gorrea, is this any vlach/romanian surname or what? + another side pf her family has surname Rrudha/Rrudho.
Gorea (single r) is not a popular surname, but it still exists. I know one person with this surname.
http://nume.ottomotor.ro/en?search=Gorea&type=circle
Same goes for Ruda.
http://nume.ottomotor.ro/en?search=Ruda&type=circle
Both are most popular in mountainous regions, so maybe they are the descendants of a settled shepherd (cioban in Romanian).
I am in the process of being tested for YSEQ J2b-M12 and I've received a part of my results today. However I really need help interpreting what it all means. My allele results are as follows:
M241 A+
PH1568 C+
Z638 G-
Z2432 G-
CTS3617 processing
Z590 processing
I think the minus sign means that I am negative for the mutation being tested, and the plus sign means that the mutation is present.
The rest of alleles are negative.
So I am M241 A+ and PH1568 C+. Is this subclade PH1568 C+ known to be specific to some region or people? Or how should I interpret it? Does anyone else shares similar results?
Garrygoamp
14-08-19, 15:29
Строительство из сэндвич панелей — это одна из современных методик, по которой сейчас строится множество промышленных сооружений — склады, ангары, сельскохозяйственные постройки (теплицы, зерно- и овощехранилища, фермы).
I am in the process of being tested for YSEQ J2b-M12 and I've received a part of my results today. However I really need help interpreting what it all means. My allele results are as follows:
M241 A+
PH1568 C+
Z638 G-
Z2432 G-
CTS3617 processing
Z590 processing
I think the minus sign means that I am negative for the mutation being tested, and the plus sign means that the mutation is present.
The rest of alleles are negative.
So I am M241 A+ and PH1568 C+. Is this subclade PH1568 C+ known to be specific to some region or people? Or how should I interpret it? Does anyone else shares similar results?
Nice, it seems YSEQ nailed your "terminal" subclade rather quickly. PH1568 is equivalent to YFull's J-Y40288. So your phylogentic position is: J-L283>...>Y15058>Z38240>PH1602>PH1568,Y40288: https://www.yfull.com/tree/J-Y15058/
As you can see, including PH1568 there is a total of 16 SNPs at YFull's J-Y40288 level, currently shared by a Serbian and a Bulgarian. So I would watch that subclade and see how it develops with more NGS tests, as it's technically possible you might be negative for some of them.
Including the FTDNA database, in this subclade there is members from Bosnia, Serbia, Bulgaria, NW Greece (Vlach), and now Romania. I think it indicates this particular subclade may have spread out with Vlachs (Romanized natives). The ancient roots, however, are most likely in the Western Balkans, since it's the same J-L283 branch as I4331, the proto-Dalmatian.
As you can see, including PH1568 there is a total of 16 SNPs at YFull's J-Y40288 level, currently shared by a Serbian and a Bulgarian. So I would watch that subclade and see how it develops with more NGS tests, as it's technically possible you might be negative for some of them.
There is actually a division within J-Y40288 as suggested by scientific samples from the Phille Hallast study. As can be seen below, PH1568 is one of the upstream SNPs, so YSEQ should test you for PH3514 next.
https://i.imgur.com/4zpZbzI.jpg
Thanks a lot Trojet for your explanations.
From my understanding CTS3617 (which is currently still processing) comes before PH1568 (J-Y40288) so it should be also positive.
In this case the only subclade below PH1568 seems PH3514. Is this the only one I should be testing at this point or also other(s)?
As for Z590 (also in processing), this comes before Z638 where I am negative, so it's not relevant anymore for me to keep digging there too.
mihaitzateo
15-08-19, 14:42
Hi all,
I just wanted to introduce myself since I am a new member of this forum.
I am Romanian, born in Bucharest and I find it fascinating to learn more about my ancestry.
As far as I know all my close relatives (up until grand-grand parents) were born in what was once called Wallachia - most of them in Moroeni - Targoviste - Ploiesti - Bucharest area. Via 23andme I have learned that my Y-DNA halplogroup is J2 (M172) > J2b (M102) > J2b2 (Z1825) > J-M241 > J-L283 and my mtDNA is J1. I just don't know how to interpret all these results. I would be very grateful if you could help a bit out here. I will be very happy to share my ancestry details on specific websites dedicated to DNA studies and to deepen my DNA search - I mean going to search further via subclades. However I don't know quite how and where to start. All ideas or suggestions are welcome.
Thank you in advance!
Moroieni were people that most likely were from SE Celtic tribes.
The local Dacians and Gothic/East Germanic tribes were calling them "Moroi", because their culture related to the night,moon and so on.
So, your J-L283 can have moved very well from Balkans to North of Danube, in Romania, with some SE Celtic ethnics, an assimilated Balkanic person, that become Celtized and later migrated in Dacia.
Mixed with local women and his descendants become Dacians/Romanians.
:)
Thanks a lot Trojet for your explanations.
From my understanding CTS3617 (which is currently still processing) comes before PH1568 (J-Y40288) so it should be also positive.
In this case the only subclade below PH1568 seems PH3514. Is this the only one I should be testing at this point or also other(s)?
As for Z590 (also in processing), this comes before Z638 where I am negative, so it's not relevant anymore for me to keep digging there too.
Yes, CTS3617 is at the same level as Y15058, so you will be positive. Z590 is at the same level as L283, so that one will be positive as well. You can find all this info in the YFull tree. All equivalent SNPs are listed next to the corresponding clade. For example at J-Y15058 there is a total of 5 SNPs (Y15058/Z34462 * CTS3617 * CTS9215* +2 SNPs)
https://www.yfull.com/tree/J-L283/
And yes, currently PH3514 is the deepest/youngest remaining SNP that would be worth testing for you, as it falls below J-PH1602>PH1568 where you are positive. I'm not sure if YSEQ will automatically include PH3514 as part of the J2b-M12 Panel. In case they don't, I would definitely inquire about it..
Moroieni were people that most likely were from SE Celtic tribes.
The local Dacians and Gothic/East Germanic tribes were calling them "Moroi", because their culture related to the night,moon and so on.
So, your J-L283 can have moved very well from Balkans to North of Danube, in Romania, with some SE Celtic ethnics, an assimilated Balkanic person, that become Celtized and later migrated in Dacia.
Mixed with local women and his descendants become Dacians/Romanians.
:)
Interesting scenario. I'm not sure about that, maybe you go a bit too far in the past.
Here's what I've personally found about that word:
"The patronym Moroianu derives from a nickname by which the inhabitants of the hill areas of Muntenia called the Romanian migrant shepherds from Bran. During the descent of the sheep, in late autumn, to their wintering places (in Romanian = “iernat”) in Balta Dunării, Dobrogea/Dobrudja and Bugeac/Budjak, they looked like frightening spirits to the locals (in Romanian = moroi), appearing into the light and heavy rain in the misty weather (in Romanian = “ploaie mocănească”). Derived from this nickname, the place-name Moroieni appears in the Subcarpathians, in Dâmbovița County, and the settlement was probably founded by the mentioned shepherds."
Anyway if you have some sources regarding the etymology of this word from another perspective, I would be glad to see them :)
<...> I'm not sure if YSEQ will automatically include PH3414 as part of the J2b-M12 Panel. In case they don't, I would definitely inquire about it..
Here's what I found on their website:
PH3514
hg38 Position: ChrY:15809390..15809390
Ancestral: G
Derived: A
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream PH1601
Forward Primer: PH3514_F AAGAAACCCTGGTTGGAAGC
Reverse Primer: PH3514_R CAGCCTGGAAACTAGCCAAC
Here's what I found on their website:
PH3514
hg38 Position: ChrY:15809390..15809390
Ancestral: G
Derived: A
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream PH1601
Forward Primer: PH3514_F AAGAAACCCTGGTTGGAAGC
Reverse Primer: PH3514_R CAGCCTGGAAACTAGCCAAC
Yes, they have it available in their catalog. But sometimes not every known SNP/subclade is included in a Panel. By inquiring, I meant in case they don't automatically test you for it, I would ask them if they will test it as part of the J2b-M12 Panel that you ordered, so you don't have to order it separately for an additional $18. I would also send them this tree from the J2 Project where it shows it downstream J-PH1602>PH1568: http://tree.j2-m172.info/?Hg=J2b2a1a1b1b1
Interesting scenario. I'm not sure about that, maybe you go a bit too far in the past.
There is one realistic scenario especially if you happen to be a basal J-Y40288. In the time of Principate Delmatae were settled to work in mines first in Eastern Dalmatia and then some were settled to Dacia. Namely mines near forts Baridustarum and Starva near Alburnus Maior/Roşia Montană.
For ex. Dasas Liccai, a Delmatae in castellum Starva from 2nd century
Panenti Bizonis, Delmatae in castellum Starva, 2nd century
From studies PH1602 seems rare in Romania, with Z631 dominating. I know of 6 J-L283, likely Z631- from Romania, 2 are missing dys456, 3 have dys456=13 so likely PH1602-, one from Mehenditi has dys456=0, and this might be a similar situation with Bulgarian study where 5 are also missing dys456, most likely they all have 12 as this clade is already present there in at least two from FTDNA.
I see from same (Basarab) study five Romanian I-L38's, 2 have dys456=13 so also a low value while three have dys456=0 again. Considering that most likely mutations from 13 are 14 and 12, and there are many with dys456=14 in the study, but no dys456=12, only dys456=0 I think indeed this is an indication that RU389 from Mehedinți has dys456=12 and is likely PH1602.
RU389
Meh
12
24
15
10
14
17
11
15
11
12
11
29
15
16
19
10
0
9
21
mihaitzateo
15-08-19, 20:21
Interesting scenario. I'm not sure about that, maybe you go a bit too far in the past.
Here's what I've personally found about that word:
"The patronym Moroianu derives from a nickname by which the inhabitants of the hill areas of Muntenia called the Romanian migrant shepherds from Bran. During the descent of the sheep, in late autumn, to their wintering places (in Romanian = “iernat”) in Balta Dunării, Dobrogea/Dobrudja and Bugeac/Budjak, they looked like frightening spirits to the locals (in Romanian = moroi), appearing into the light and heavy rain in the misty weather (in Romanian = “ploaie mocănească”). Derived from this nickname, the place-name Moroieni appears in the Subcarpathians, in Dâmbovița County, and the settlement was probably founded by the mentioned shepherds."
Anyway if you have some sources regarding the etymology of this word from another perspective, I would be glad to see them :)
Oh.
Very interesting.
So in Moroieni are people that came from Bran.
Both Celts and Dacians were mostly pastolarist people.
Another thing, Bran is one of the few name places in Romania,that is almost surely of Celtic origins :) .
Bran means Raven in Celtic languages. Or maybe is a coincidence, who knows .
Did you also made an autosomal DNA and if you made, can you share your results or just Y DNA and MT-DNA?
Yes, they have it available in their catalog. But sometimes not every known SNP/subclade is included in a Panel. By inquiring, I meant in case they don't automatically test you for it, I would ask them if they will test it as part of the J2b-M12 Panel that you ordered, so you don't have to order it separately for an additional $18. I would also send them this tree from the J2 Project where it shows it downstream J-PH1602>PH1568: http://tree.j2-m172.info/?Hg=J2b2a1a1b1b1
I've asked them and they will test it as a part of J2b-M12 Panel. As soon as I get the final results I will update everything here.
<...> Did you also made an autosomal DNA and if you made, can you share your results or just Y DNA and MT-DNA?
Y-DNA and mtDNA with 23andMe which revealed J-L283 and then I ordered YSEQ J2b-M12 Panel as Trojet recommended.
mihaitzateo
16-08-19, 17:12
Y-DNA and mtDNA with 23andMe which revealed J-L283 and then I ordered YSEQ J2b-M12 Panel as Trojet recommended.
I was curious about Autosomal DNA, also.
I was curious about Autosomal DNA, also.
Only the 23andMe’s autosomal bundle test which is reflected in their Ancestry Service. So if this is what you’re after, then here's my ancestry composition:
1131511316113171131811319
[Цитат = mihaitzateo; 583813] О.
Много интересно.
Така че в Мороени са хора, дошли от Бран.
И келтите, и даките бяха предимно пастоларисти.
Друго нещо, Бран е едно от малкото имена места в Румъния, което почти сигурно е от келтски произход :).
Бран означава Гарван на келтски езици. Или може би е случайност, кой знае.
Направихте ли и автозомна ДНК и ако сте направили, можете ли да споделите резултатите си или просто Y ДНК и МТ-ДНК? [/ ЦИТАТ]
In Old Slavic Bran means military action /defense/. From here in Bulgarian the word -otBrana-defense, and in Russian- oBorona /defense/. Mor- From Old East Slavic (https://en.wikipedia.org/wiki/Old_East_Slavic) моръ (https://en.wiktionary.org/wiki/%D0%BC%D0%BE%D1%80%D1%8A#Old_East_Slavic) (morŭ), from Proto-Slavic (https://en.wikipedia.org/wiki/Proto-Slavic) *morъ (https://en.wiktionary.org/wiki/Reconstruction:Proto-Slavic/mor%D1%8A). In the face of a deadly disease or natural disaster that destroys many people or animals; epidemic.
mihaitzateo
17-08-19, 23:37
[Цитат = mihaitzateo; 583813] О.
Много интересно.
Така че в Мороени са хора, дошли от Бран.
И келтите, и даките бяха предимно пастоларисти.
Друго нещо, Бран е едно от малкото имена места в Румъния, което почти сигурно е от келтски произход :).
Бран означава Гарван на келтски езици. Или може би е случайност, кой знае.
Направихте ли и автозомна ДНК и ако сте направили, можете ли да споделите резултатите си или просто Y ДНК и МТ-ДНК? [/ ЦИТАТ]
In Old Slavic Bran means military action /defense/. From here in Bulgarian the word -otBrana-defense, and in Russian- oBorona /defense/. Mor- From Old East Slavic (https://en.wikipedia.org/wiki/Old_East_Slavic) моръ (https://en.wiktionary.org/wiki/%D0%BC%D0%BE%D1%80%D1%8A#Old_East_Slavic) (morŭ), from Proto-Slavic (https://en.wikipedia.org/wiki/Proto-Slavic) *morъ (https://en.wiktionary.org/wiki/Reconstruction:Proto-Slavic/mor%D1%8A). In the face of a deadly disease or natural disaster that destroys many people or animals; epidemic.
Well that area is a mountain area and most people there are very white skinned but mostly dark haired.
Besides most are herding sheep and some are herding sheep and cows.
This is not looking very Slavic like.
Also, Alpinid is quite common in the area,as race.
So surely they have some Celtic blood, but what kind of Celts, that is the question.
There is actually a division within J-Y40288 as suggested by scientific samples from the Phille Hallast study. As can be seen below, PH1568 is one of the upstream SNPs, so YSEQ should test you for PH3514 next.
https://i.imgur.com/4zpZbzI.jpg
I have an important update for this thread: YSEQ informed me that my final haplogroup is PH3514. Any ideas how I can contribute with my result to the existent information? I mean where and how can I upload my YSEQ J2b-M12 Panel results so they can be visible on Yfull, FTDNA or other site(s) of this kind?
I have an important update for this thread: YSEQ informed me that my final haplogroup is PH3514. Any ideas how I can contribute with my result to the existent information? I mean where and how can I upload my YSEQ J2b-M12 Panel results so they can be visible on Yfull, FTDNA or other site(s) of this kind?
Great, congrats on determining your subclade! However, as of right now, the only way for your result to be uploaded to YFull is to do a deep test (BigY/NGS).
Powered by vBulletin® Version 4.2.5 Copyright © 2021 vBulletin Solutions Inc. All rights reserved.