Eupedia Forums
Site NavigationEupedia Top > Eupedia Forum & Japan Forum

Search:

Type: Posts; User: Joey37

Page 1 of 10 1 2 3 4

Search: Search took 0.01 seconds.

  1. Replies
    1
    Views
    54

    Oh, that's Sahul...at first I thought you just...

    Oh, that's Sahul...at first I thought you just misspelled Sahel. Yes, New Guinea makes more sense, it is much closer.
  2. Replies
    58
    Views
    222,014

    My sister's third toe is the longest on her foot....

    My sister's third toe is the longest on her foot. Sadly, at least one of her children has inherited this unfortunate malformation. I attribute it to fallout from Three Mile Island, which occurred...
  3. Replies
    8
    Views
    2,200

    Bell Beaker Scotland 2145 BC? That reminds me of...

    Bell Beaker Scotland 2145 BC? That reminds me of my #1 match on Mytrueancestry.com, at a distance of 3.38, and I am R1a. (77% British Isles DNA according to Ancestry, so that's probably why)
  4. Replies
    14
    Views
    5,506

    Ricki, did you test via Ancestry? Because when I...

    Ricki, did you test via Ancestry? Because when I uploaded my Ancestry to WeGene, it gave me mtdna haplogroup R, whereas from 23andMe testing I know I am J1c2b; haplogroup J is descended from R, so...
  5. It also could be Middle Eastern. My MDLP K23b...

    It also could be Middle Eastern. My MDLP K23b for 88% NW European, 11.5% Sicilian, and 0.5% Native American is as follows:

    Single Population Sharing:



    #
    Population (source)
    Distance
  6. Replies
    14
    Views
    19,967

    My dad is RH negative, but he is R1a.

    My dad is RH negative, but he is R1a.
  7. Replies
    267
    Views
    11,350

    My closest match is Bell Beaker Scotland (2145...

    My closest match is Bell Beaker Scotland (2145 BC) 3.668, and I have one from Girona, Spain, but a Visigoth, at 5.45
  8. VISIGOTH! My y-haplogroup is R1a, which is found...

    VISIGOTH! My y-haplogroup is R1a, which is found in Scandinavia, as is my mtdna haplogroup, J1c2b, which has many samples from Denmark. Also mytrueancestry.com has Visigoth as one of the groups I...
  9. Replies
    922
    Views
    29,750

    11133I looked at mine again...I share DNA with...

    11133I looked at mine again...I share DNA with Celtic/Viking Iceland 1000AD...hey I could be Bjork's brother11132
  10. Replies
    28
    Views
    763

    Oh, yes, 9.5% of a haplogroup is an abundance. ...

    Oh, yes, 9.5% of a haplogroup is an abundance. And I'm using data from this site. That is the same amount as the percentage of R1a in western Germany (where my male line comes from) and that is...
  11. Replies
    28
    Views
    763

    As R1b and E1b are not particularly common in...

    As R1b and E1b are not particularly common in Iran, I would guess it was some kind of founder effect/genetic bottleneck that resulted in these current haplogroup percentages. J2 is the only one I...
  12. I'm homozygous GTCAGTATCAATTCTGGAAG AATTTCCAGACA...

    I'm homozygous GTCAGTATCAATTCTGGAAG AATTTCCAGACA / GTCAGTATCAATTCTGGAAGAATTTCCAGACA, ​so I guess the same as you guys.
  13. Replies
    5
    Views
    292

    Very curious, as the only continental European...

    Very curious, as the only continental European samples per YFull are in Denmark and Italy. In the Eupedia map L21 is only present in the southwestern Czech Republic.
  14. Replies
    3
    Views
    217

    I once read an article in the National Geographic...

    I once read an article in the National Geographic on him. He was from Morocco, I believe.
  15. Does anyone know if it's an extinct species or...

    Does anyone know if it's an extinct species or one with living descendants?
  16. The first one sounds like a German trying to...

    The first one sounds like a German trying to speak Portuguese. The second sounds like an Italian-Greek mix.
  17. Replies
    42
    Views
    1,058

    No one should promote what is basically an...

    No one should promote what is basically an evolutionary dead end. It's irresponsible. This is the kind of tripe that makes the alt-right think there is a secret cabal of Jews intent on eliminating...
  18. Replies
    557
    Views
    112,940

    Y-haplogroups and your closest match on...

    Y-haplogroups and your closest match on Mytrueancestry.com may not be exactly equivalent; my haplogroup is R1a and my closest match is Bell Beaker Scotland, 2150 BC. If they ever found R1a in Bell...
  19. Replies
    139
    Views
    24,709

    11102Okay I took a screenshot

    11102Okay I took a screenshot
  20. Wow, W is the main Indo-European maternal steppe...

    Wow, W is the main Indo-European maternal steppe lineage. It is the mtdna version of my y-haplogroup R1a. It is quite rare far from the steppe, as women didn't migrate as far as the men. W1c is...
  21. Replies
    73
    Views
    2,203

    11095El beagle ingles, bane to all leporids!

    11095El beagle ingles, bane to all leporids!
  22. Replies
    267
    Views
    11,350

    I get samples from Iberia in my...

    I get samples from Iberia in my Mytrueancestry.com, but they're Visigoths.
  23. Replies
    3
    Views
    605

    A4a1 is an east Eurasian lineage, and could mean...

    A4a1 is an east Eurasian lineage, and could mean one of two things for an American. It is found among Native American tribes and therefore could indicate a Native matrilineal origin, or it could...
  24. Thread: MDLP K16 Modern

    by Joey37
    Replies
    97
    Views
    14,110

    That was from the 23andMe test. Here is the...

    That was from the 23andMe test. Here is the results from my Ancestry test.
    Admix Results (sorted):



    #
    Population
    Percent
  25. I2a-Din may be a crucial clue as to the location...

    I2a-Din may be a crucial clue as to the location of the very first Slavs. The upper Vistula River and Carpathian Mountains area is the favored place of origin in my theories for the Early Slavic...
Results 1 to 25 of 227
Page 1 of 10 1 2 3 4