Eupedia Forums
Site NavigationEupedia Top > Eupedia Forum & Japan Forum
Results 1 to 7 of 7

Thread: Homozygous CCR5-∆32 is bad news for longevity

  1. #1
    Advisor Angela's Avatar
    Join Date
    02-01-11
    Posts
    21,699


    Ethnic group
    Italian
    Country: USA - New York



    Homozygous CCR5-∆32 is bad news for longevity

    See:
    https://www.nature.com/articles/s41591-019-0459-6

    My raw data at 23andme says it can't be found. Perhaps they don't test for it?

    "We use the genotyping and death register information of 409,693 individuals of British ancestry to investigate fitness effects of the CCR5-∆32 mutation. We estimate a 21% increase in the all-cause mortality rate in individuals who are homozygous for the ∆32 allele. A deleterious effect of the ∆32/∆32 mutation is also independently supported by a significant deviation from the Hardy–Weinberg equilibrium (HWE) due to a deficiency of ∆32/∆32 individuals at the time of recruitment."


    Non si fa il proprio dovere perchè qualcuno ci dica grazie, lo si fa per principio, per se stessi, per la propria dignità. Oriana Fallaci

  2. #2
    Regular Member Regio X's Avatar
    Join Date
    12-03-14
    Posts
    1,111


    Country: Italy



    @Angela
    Check/browse the i3003626 in 23andMe.

    https://www.snpedia.com/index.php/Rs333

    https://www.snpedia.com/index.php/I3003626

    It seems (D,D) is more common in North Europe. If it's bad news for longevity, at least it potentially provides immunity against HIV and plague, if I get it right.
    I'm (I,I), or GTCAGTATCAATTCTGGAAGAATTTCCAGACA / GTCAGTATCAATTCTGGAAGAATTTCCAGACA.

  3. #3
    Advisor Angela's Avatar
    Join Date
    02-01-11
    Posts
    21,699


    Ethnic group
    Italian
    Country: USA - New York



    1 members found this post helpful.
    Quote Originally Posted by Regio X View Post
    @Angela
    Check/browse the i3003626 in 23andMe.

    https://www.snpedia.com/index.php/Rs333

    https://www.snpedia.com/index.php/I3003626

    It seems (D,D) is more common in North Europe. If it's bad news for longevity, at least it potentially provides immunity against HIV and plague, if I get it right.
    I'm (I,I), or GTCAGTATCAATTCTGGAAGAATTTCCAGACA / GTCAGTATCAATTCTGGAAGAATTTCCAGACA.
    Thanks, Regio.

    I can't understand what it's telling me.
    CCR5 i3003626 46414947 — or GTCAGTATCAATTCTGGAAGAATTTCCAGACA GTCAGTATCAATTCTGGAAGAATTTCCAGACA / GTCAGTATCAATTCTGGAAGAATTTCCAGACA


    I started going cross eyed, but I think we're the same, yes? Which means what? We don't carry the mutated version? Which means unless we're exposed to HIV or plague it's good news?

    I think the likelihood I'll be exposed to either is small. :)

  4. #4
    Regular Member Joey37's Avatar
    Join Date
    11-06-18
    Location
    Coventry, Rhode Island
    Posts
    464

    Y-DNA haplogroup
    R1a-YP445
    MtDNA haplogroup
    J1c2b

    Ethnic group
    Celto-Germanic
    Country: USA - Rhode Island



    I'm homozygous GTCAGTATCAATTCTGGAAG AATTTCCAGACA / GTCAGTATCAATTCTGGAAGAATTTCCAGACA, ​so I guess the same as you guys.

  5. #5
    Regular Member Regio X's Avatar
    Join Date
    12-03-14
    Posts
    1,111


    Country: Italy



    Quote Originally Posted by Angela View Post
    Thanks, Regio.

    I can't understand what it's telling me.
    CCR5 i3003626 46414947 — or GTCAGTATCAATTCTGGAAGAATTTCCAGACA GTCAGTATCAATTCTGGAAGAATTTCCAGACA / GTCAGTATCAATTCTGGAAGAATTTCCAGACA


    I started going cross eyed, but I think we're the same, yes? Which means what? We don't carry the mutated version? Which means unless we're exposed to HIV or plague it's good news?

    I think the likelihood I'll be exposed to either is small. :)
    Yes, same as mine. It means we don't have the mutation (deletion of 32-base-pair, hence the "delta"), which would affect longevity in a negative way. But it would indeed protect from HIV.

    "CCR5 Δ32 is a 32-base-pair deletion that introduces a premature stop codon into the CCR5 receptor locus, resulting in a nonfunctional receptor. CCR5 is required for M-tropic HIV-1 virus entry. Individuals homozygous (denoted Δ32/Δ32) for CCR5 Δ32 do not express functional CCR5 receptors on their cell surfaces and are resistant to HIV-1 infection, despite multiple high-risk exposures."
    https://en.wikipedia.org/wiki/CCR5

    It was hypothesized far back, in 2001, that it was spread by Vikings, but I'm not sure it makes sense:
    https://www.ncbi.nlm.nih.gov/pubmed/11543895

    The likelihood I'll be exposed to it is small as well. I certainly prefer longevity, je je je.

  6. #6
    Advisor Angela's Avatar
    Join Date
    02-01-11
    Posts
    21,699


    Ethnic group
    Italian
    Country: USA - New York



    Quote Originally Posted by Regio X View Post
    Yes, same as mine. It means we don't have the mutation (deletion of 32-base-pair, hence the "delta"), which would affect longevity in a negative way. But it would indeed protect from HIV.
    "CCR5 Δ32 is a 32-base-pair deletion that introduces a premature stop codon into the CCR5 receptor locus, resulting in a nonfunctional receptor. CCR5 is required for M-tropic HIV-1 virus entry. Individuals homozygous (denoted Δ32/Δ32) for CCR5 Δ32 do not express functional CCR5 receptors on their cell surfaces and are resistant to HIV-1 infection, despite multiple high-risk exposures."
    https://en.wikipedia.org/wiki/CCR5
    It was hypothesized far back, in 2001, that it was spread by Vikings, but I'm not sure it makes sense:
    https://www.ncbi.nlm.nih.gov/pubmed/11543895
    The likelihood I'll be exposed to it is small as well. I certainly prefer longevity, je je je.
    Makes sense. About 90% of the population of the town of Fivizzano in the Lunigiana died of the plague during the Middle Ages.

    Glad I'm living now. :)

    I'm sure there are multiple reasons, but we do have a quite extraordinary percentage of the population who are over 90 years old.

  7. #7
    Junior Member
    Join Date
    30-11-22
    Posts
    1


    Country: USA - California



    It had been reported widely in the media at the time He Jiankui did his CRISPR CCR5 knockout
    on the 2 or 3 IVF children that the double deletion of CCR5 might actually reduce fitness
    and longevity.

    A study came out saying that they had found an effect in UK.
    CCR5-Δ32 is deleterious in the homozygous state in humans
    Xinzhu Wei1 and Rasmus Nielsen

    But now it appears that was just a technical error:

    pmc articles PMC7302696

    These analyses show that the original reports of a recessive deleterious effect of CCR5-Δ32 are affected by a technical artifact,
    and that a closer investigation of the same data provides no positive evidence for an effect on lifespan.

Similar Threads

  1. Is Goji really that bad?
    By mojoii in forum Life Sciences
    Replies: 0
    Last Post: 14-05-17, 06:47
  2. Are proteins bad for your health ?
    By Maciamo in forum Medical & Psychological Genetics
    Replies: 18
    Last Post: 03-08-14, 15:57
  3. Stem Cells - the key to longevity.
    By LeBrok in forum Life Sciences
    Replies: 0
    Last Post: 03-05-14, 17:19
  4. Bad news: global warming will increase incidence of earthquakes and tsunamis
    By Maciamo in forum Nature, Environment & Ecology
    Replies: 3
    Last Post: 16-04-12, 20:32

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •