Eupedia Forums
Site NavigationEupedia Top > Eupedia Forum & Japan Forum
Page 2 of 2 FirstFirst 12
Results 26 to 44 of 44

Thread: Introduction new member (Y-DNA: J-L283)

  1. #26
    Junior Member Achievements:
    100 Experience Points7 days registered

    Join Date
    02-08-19
    Location
    РФ
    Posts
    1
    Points
    156
    Level
    2
    Points: 156, Level: 2
    Level completed: 6%, Points required for next Level: 94
    Overall activity: 0%

    Y-DNA haplogroup
    Garrygoamp
    MtDNA haplogroup
    Garrygoamp

    Ethnic group
    84524991744
    Country: India



    0 out of 2 members found this post helpful.
    Строительство из сэндвич панелей — это одна из современных методик, по которой сейчас строится множество промышленных сооружений — склады, ангары, сельскохозяйственные постройки (теплицы, зерно- и овощехранилища, фермы).

  2. #27
    Regular Member Achievements:
    Recommendation Second ClassThree FriendsVeteran5000 Experience Points

    Join Date
    17-01-15
    Posts
    326
    Points
    5,911
    Level
    22
    Points: 5,911, Level: 22
    Level completed: 73%, Points required for next Level: 139
    Overall activity: 9.0%

    Y-DNA haplogroup
    J-L283

    Country: Albania



    4 out of 4 members found this post helpful.
    Quote Originally Posted by telsh View Post
    I am in the process of being tested for YSEQ J2b-M12 and I've received a part of my results today. However I really need help interpreting what it all means. My allele results are as follows:
    M241 A+
    PH1568 C+
    Z638 G-
    Z2432 G-
    CTS3617 processing
    Z590 processing
    I think the minus sign means that I am negative for the mutation being tested, and the plus sign means that the mutation is present.
    The rest of alleles are negative.

    So I am M241 A+ and PH1568 C+. Is this subclade PH1568 C+ known to be specific to some region or people? Or how should I interpret it? Does anyone else shares similar results?
    Nice, it seems YSEQ nailed your "terminal" subclade rather quickly. PH1568 is equivalent to YFull's J-Y40288. So your phylogentic position is: J-L283>...>Y15058>Z38240>PH1602>PH1568,Y40288: https://www.yfull.com/tree/J-Y15058/

    As you can see, including PH1568 there is a total of 16 SNPs at YFull's J-Y40288 level, currently shared by a Serbian and a Bulgarian. So I would watch that subclade and see how it develops with more NGS tests, as it's technically possible you might be negative for some of them.

    Including the FTDNA database, in this subclade there is members from Bosnia, Serbia, Bulgaria, NW Greece (Vlach), and now Romania. I think it indicates this particular subclade may have spread out with Vlachs (Romanized natives). The ancient roots, however, are most likely in the Western Balkans, since it's the same J-L283 branch as I4331, the proto-Dalmatian.
    Y-DNA: J-L283
    Maternal Y-DNA: E-V13

  3. #28
    Regular Member Achievements:
    Recommendation Second ClassThree FriendsVeteran5000 Experience Points

    Join Date
    17-01-15
    Posts
    326
    Points
    5,911
    Level
    22
    Points: 5,911, Level: 22
    Level completed: 73%, Points required for next Level: 139
    Overall activity: 9.0%

    Y-DNA haplogroup
    J-L283

    Country: Albania



    2 out of 2 members found this post helpful.
    Quote Originally Posted by Trojet View Post
    As you can see, including PH1568 there is a total of 16 SNPs at YFull's J-Y40288 level, currently shared by a Serbian and a Bulgarian. So I would watch that subclade and see how it develops with more NGS tests, as it's technically possible you might be negative for some of them.
    There is actually a division within J-Y40288 as suggested by scientific samples from the Phille Hallast study. As can be seen below, PH1568 is one of the upstream SNPs, so YSEQ should test you for PH3514 next.


  4. #29
    Regular Member Achievements:
    250 Experience Points3 months registered

    Join Date
    07-06-19
    Location
    Bucharest
    Posts
    15
    Points
    391
    Level
    4
    Points: 391, Level: 4
    Level completed: 41%, Points required for next Level: 59
    Overall activity: 0%

    Y-DNA haplogroup
    J-L283>...>PH3514
    MtDNA haplogroup
    J1c2

    Country: Romania



    Thanks a lot Trojet for your explanations.


    From my understanding CTS3617 (which is currently still processing) comes before PH1568 (J-Y40288) so it should be also positive.


    In this case the only subclade below PH1568 seems PH3514. Is this the only one I should be testing at this point or also other(s)?


    As for Z590 (also in processing), this comes before Z638 where I am negative, so it's not relevant anymore for me to keep digging there too.

  5. #30
    Regular Member Achievements:
    Veteran10000 Experience Points

    Join Date
    13-01-12
    Location
    Bucharest
    Posts
    923
    Points
    13,028
    Level
    34
    Points: 13,028, Level: 34
    Level completed: 54%, Points required for next Level: 322
    Overall activity: 4.0%

    Y-DNA haplogroup
    proly R1B

    Ethnic group
    Romanian
    Country: Romania



    Quote Originally Posted by telsh View Post
    Hi all,


    I just wanted to introduce myself since I am a new member of this forum.


    I am Romanian, born in Bucharest and I find it fascinating to learn more about my ancestry.


    As far as I know all my close relatives (up until grand-grand parents) were born in what was once called Wallachia - most of them in Moroeni - Targoviste - Ploiesti - Bucharest area. Via 23andme I have learned that my Y-DNA halplogroup is J2 (M172) > J2b (M102) > J2b2 (Z1825) > J-M241 > J-L283 and my mtDNA is J1. I just don't know how to interpret all these results. I would be very grateful if you could help a bit out here. I will be very happy to share my ancestry details on specific websites dedicated to DNA studies and to deepen my DNA search - I mean going to search further via subclades. However I don't know quite how and where to start. All ideas or suggestions are welcome.

    Thank you in advance!
    Moroieni were people that most likely were from SE Celtic tribes.
    The local Dacians and Gothic/East Germanic tribes were calling them "Moroi", because their culture related to the night,moon and so on.
    So, your J-L283 can have moved very well from Balkans to North of Danube, in Romania, with some SE Celtic ethnics, an assimilated Balkanic person, that become Celtized and later migrated in Dacia.
    Mixed with local women and his descendants become Dacians/Romanians.
    :)

  6. #31
    Regular Member Achievements:
    Recommendation Second ClassThree FriendsVeteran5000 Experience Points

    Join Date
    17-01-15
    Posts
    326
    Points
    5,911
    Level
    22
    Points: 5,911, Level: 22
    Level completed: 73%, Points required for next Level: 139
    Overall activity: 9.0%

    Y-DNA haplogroup
    J-L283

    Country: Albania



    Quote Originally Posted by telsh View Post
    Thanks a lot Trojet for your explanations.
    From my understanding CTS3617 (which is currently still processing) comes before PH1568 (J-Y40288) so it should be also positive.
    In this case the only subclade below PH1568 seems PH3514. Is this the only one I should be testing at this point or also other(s)?
    As for Z590 (also in processing), this comes before Z638 where I am negative, so it's not relevant anymore for me to keep digging there too.
    Yes, CTS3617 is at the same level as Y15058, so you will be positive. Z590 is at the same level as L283, so that one will be positive as well. You can find all this info in the YFull tree. All equivalent SNPs are listed next to the corresponding clade. For example at J-Y15058 there is a total of 5 SNPs (Y15058/Z34462 * CTS3617 * CTS9215* +2 SNPs)
    https://www.yfull.com/tree/J-L283/

    And yes, currently PH3514 is the deepest/youngest remaining SNP that would be worth testing for you, as it falls below J-PH1602>PH1568 where you are positive. I'm not sure if YSEQ will automatically include PH3514 as part of the J2b-M12 Panel. In case they don't, I would definitely inquire about it..
    Last edited by Trojet; 18-08-19 at 01:56. Reason: Fixed typo

  7. #32
    Regular Member Achievements:
    250 Experience Points3 months registered

    Join Date
    07-06-19
    Location
    Bucharest
    Posts
    15
    Points
    391
    Level
    4
    Points: 391, Level: 4
    Level completed: 41%, Points required for next Level: 59
    Overall activity: 0%

    Y-DNA haplogroup
    J-L283>...>PH3514
    MtDNA haplogroup
    J1c2

    Country: Romania



    1 out of 1 members found this post helpful.
    Quote Originally Posted by mihaitzateo View Post
    Moroieni were people that most likely were from SE Celtic tribes.
    The local Dacians and Gothic/East Germanic tribes were calling them "Moroi", because their culture related to the night,moon and so on.
    So, your J-L283 can have moved very well from Balkans to North of Danube, in Romania, with some SE Celtic ethnics, an assimilated Balkanic person, that become Celtized and later migrated in Dacia.
    Mixed with local women and his descendants become Dacians/Romanians.
    :)
    Interesting scenario. I'm not sure about that, maybe you go a bit too far in the past.

    Here's what I've personally found about that word:

    "The patronym Moroianu derives from a nickname by which the inhabitants of the hill areas of Muntenia called the Romanian migrant shepherds from Bran. During the descent of the sheep, in late autumn, to their wintering places (in Romanian = “iernat”) in Balta Dunării, Dobrogea/Dobrudja and Bugeac/Budjak, they looked like frightening spirits to the locals (in Romanian = moroi), appearing into the light and heavy rain in the misty weather (in Romanian = “ploaie mocănească”). Derived from this nickname, the place-name Moroieni appears in the Subcarpathians, in Dâmbovița County, and the settlement was probably founded by the mentioned shepherds."

    Anyway if you have some sources regarding the etymology of this word from another perspective, I would be glad to see them :)

  8. #33
    Regular Member Achievements:
    250 Experience Points3 months registered

    Join Date
    07-06-19
    Location
    Bucharest
    Posts
    15
    Points
    391
    Level
    4
    Points: 391, Level: 4
    Level completed: 41%, Points required for next Level: 59
    Overall activity: 0%

    Y-DNA haplogroup
    J-L283>...>PH3514
    MtDNA haplogroup
    J1c2

    Country: Romania



    Quote Originally Posted by Trojet
    <...> I'm not sure if YSEQ will automatically include PH3414 as part of the J2b-M12 Panel. In case they don't, I would definitely inquire about it..
    Here's what I found on their website:

    PH3514

    hg38 Position: ChrY:15809390..15809390
    Ancestral: G
    Derived: A
    Reference: Pille Hallast et al. (2014)
    ISOGG Haplogroup: J2 (not listed)
    Comments: Downstream PH1601
    Forward Primer: PH3514_F AAGAAACCCTGGTTGGAAGC
    Reverse Primer: PH3514_R CAGCCTGGAAACTAGCCAAC

  9. #34
    Regular Member Achievements:
    Recommendation Second ClassThree FriendsVeteran5000 Experience Points

    Join Date
    17-01-15
    Posts
    326
    Points
    5,911
    Level
    22
    Points: 5,911, Level: 22
    Level completed: 73%, Points required for next Level: 139
    Overall activity: 9.0%

    Y-DNA haplogroup
    J-L283

    Country: Albania



    Quote Originally Posted by telsh View Post
    Here's what I found on their website:
    PH3514

    hg38 Position: ChrY:15809390..15809390
    Ancestral: G
    Derived: A
    Reference: Pille Hallast et al. (2014)
    ISOGG Haplogroup: J2 (not listed)
    Comments: Downstream PH1601
    Forward Primer: PH3514_F AAGAAACCCTGGTTGGAAGC
    Reverse Primer: PH3514_R CAGCCTGGAAACTAGCCAAC
    Yes, they have it available in their catalog. But sometimes not every known SNP/subclade is included in a Panel. By inquiring, I meant in case they don't automatically test you for it, I would ask them if they will test it as part of the J2b-M12 Panel that you ordered, so you don't have to order it separately for an additional $18. I would also send them this tree from the J2 Project where it shows it downstream J-PH1602>PH1568: http://tree.j2-m172.info/?Hg=J2b2a1a1b1b1

  10. #35
    Regular Member Achievements:
    1000 Experience Points1 year registered

    Join Date
    04-03-18
    Posts
    281
    Points
    3,150
    Level
    16
    Points: 3,150, Level: 16
    Level completed: 25%, Points required for next Level: 300
    Overall activity: 39.0%

    Y-DNA haplogroup
    E-Z17107>A24048
    MtDNA haplogroup
    I1a1a

    Ethnic group
    Qun, Ermi
    Country: Bosnia & Herzegovina



    Quote Originally Posted by telsh View Post
    Interesting scenario. I'm not sure about that, maybe you go a bit too far in the past.
    There is one realistic scenario especially if you happen to be a basal J-Y40288. In the time of Principate Delmatae were settled to work in mines first in Eastern Dalmatia and then some were settled to Dacia. Namely mines near forts Baridustarum and Starva near Alburnus Maior/Roşia Montană.

    For ex. Dasas Liccai, a Delmatae in castellum Starva from 2nd century
    Panenti Bizonis, Delmatae in castellum Starva, 2nd century

    From studies PH1602 seems rare in Romania, with Z631 dominating. I know of 6 J-L283, likely Z631- from Romania, 2 are missing dys456, 3 have dys456=13 so likely PH1602-, one from Mehenditi has dys456=0, and this might be a similar situation with Bulgarian study where 5 are also missing dys456, most likely they all have 12 as this clade is already present there in at least two from FTDNA.

    I see from same (Basarab) study five Romanian I-L38's, 2 have dys456=13 so also a low value while three have dys456=0 again. Considering that most likely mutations from 13 are 14 and 12, and there are many with dys456=14 in the study, but no dys456=12, only dys456=0 I think indeed this is an indication that RU389 from Mehedinți has dys456=12 and is likely PH1602.

    RU389 Meh 12 24 15 10 14 17 11 15 11 12 11 29 15 16 19 10 0 9 21

  11. #36
    Regular Member Achievements:
    Veteran10000 Experience Points

    Join Date
    13-01-12
    Location
    Bucharest
    Posts
    923
    Points
    13,028
    Level
    34
    Points: 13,028, Level: 34
    Level completed: 54%, Points required for next Level: 322
    Overall activity: 4.0%

    Y-DNA haplogroup
    proly R1B

    Ethnic group
    Romanian
    Country: Romania



    1 out of 1 members found this post helpful.
    Quote Originally Posted by telsh View Post
    Interesting scenario. I'm not sure about that, maybe you go a bit too far in the past.

    Here's what I've personally found about that word:

    "The patronym Moroianu derives from a nickname by which the inhabitants of the hill areas of Muntenia called the Romanian migrant shepherds from Bran. During the descent of the sheep, in late autumn, to their wintering places (in Romanian = “iernat”) in Balta Dunării, Dobrogea/Dobrudja and Bugeac/Budjak, they looked like frightening spirits to the locals (in Romanian = moroi), appearing into the light and heavy rain in the misty weather (in Romanian = “ploaie mocănească”). Derived from this nickname, the place-name Moroieni appears in the Subcarpathians, in Dâmbovița County, and the settlement was probably founded by the mentioned shepherds."

    Anyway if you have some sources regarding the etymology of this word from another perspective, I would be glad to see them :)
    Oh.
    Very interesting.
    So in Moroieni are people that came from Bran.
    Both Celts and Dacians were mostly pastolarist people.
    Another thing, Bran is one of the few name places in Romania,that is almost surely of Celtic origins :) .
    Bran means Raven in Celtic languages. Or maybe is a coincidence, who knows .
    Did you also made an autosomal DNA and if you made, can you share your results or just Y DNA and MT-DNA?

  12. #37
    Regular Member Achievements:
    250 Experience Points3 months registered

    Join Date
    07-06-19
    Location
    Bucharest
    Posts
    15
    Points
    391
    Level
    4
    Points: 391, Level: 4
    Level completed: 41%, Points required for next Level: 59
    Overall activity: 0%

    Y-DNA haplogroup
    J-L283>...>PH3514
    MtDNA haplogroup
    J1c2

    Country: Romania



    Quote Originally Posted by Trojet View Post
    Yes, they have it available in their catalog. But sometimes not every known SNP/subclade is included in a Panel. By inquiring, I meant in case they don't automatically test you for it, I would ask them if they will test it as part of the J2b-M12 Panel that you ordered, so you don't have to order it separately for an additional $18. I would also send them this tree from the J2 Project where it shows it downstream J-PH1602>PH1568: http://tree.j2-m172.info/?Hg=J2b2a1a1b1b1
    I've asked them and they will test it as a part of J2b-M12 Panel. As soon as I get the final results I will update everything here.
    Last edited by telsh; 16-08-19 at 12:16. Reason: Text spelling

  13. #38
    Regular Member Achievements:
    250 Experience Points3 months registered

    Join Date
    07-06-19
    Location
    Bucharest
    Posts
    15
    Points
    391
    Level
    4
    Points: 391, Level: 4
    Level completed: 41%, Points required for next Level: 59
    Overall activity: 0%

    Y-DNA haplogroup
    J-L283>...>PH3514
    MtDNA haplogroup
    J1c2

    Country: Romania



    1 out of 1 members found this post helpful.
    Quote Originally Posted by mihaitzateo View Post
    <...> Did you also made an autosomal DNA and if you made, can you share your results or just Y DNA and MT-DNA?
    Y-DNA and mtDNA with 23andMe which revealed J-L283 and then I ordered YSEQ J2b-M12 Panel as Trojet recommended.

  14. #39
    Regular Member Achievements:
    Veteran10000 Experience Points

    Join Date
    13-01-12
    Location
    Bucharest
    Posts
    923
    Points
    13,028
    Level
    34
    Points: 13,028, Level: 34
    Level completed: 54%, Points required for next Level: 322
    Overall activity: 4.0%

    Y-DNA haplogroup
    proly R1B

    Ethnic group
    Romanian
    Country: Romania



    1 out of 1 members found this post helpful.
    Quote Originally Posted by telsh View Post
    Y-DNA and mtDNA with 23andMe which revealed J-L283 and then I ordered YSEQ J2b-M12 Panel as Trojet recommended.
    I was curious about Autosomal DNA, also.

  15. #40
    Regular Member Achievements:
    250 Experience Points3 months registered

    Join Date
    07-06-19
    Location
    Bucharest
    Posts
    15
    Points
    391
    Level
    4
    Points: 391, Level: 4
    Level completed: 41%, Points required for next Level: 59
    Overall activity: 0%

    Y-DNA haplogroup
    J-L283>...>PH3514
    MtDNA haplogroup
    J1c2

    Country: Romania



    1 out of 1 members found this post helpful.
    Quote Originally Posted by mihaitzateo View Post
    I was curious about Autosomal DNA, also.
    Only the 23andMe’s autosomal bundle test which is reflected in their Ancestry Service. So if this is what you’re after, then here's my ancestry composition:

    Attachment 11315Attachment 11316Attachment 11317Attachment 11318Attachment 11319

  16. #41
    Regular Member Achievements:
    500 Experience Points3 months registered
    Krum's Avatar
    Join Date
    29-06-19
    Location
    Varna
    Posts
    49
    Points
    675
    Level
    6
    Points: 675, Level: 6
    Level completed: 63%, Points required for next Level: 75
    Overall activity: 2.0%

    Y-DNA haplogroup
    E-V13

    Ethnic group
    Bulgarian
    Country: Bulgaria



    [Цитат = mihaitzateo; 583813] О.
    Много интересно.
    Така че в Мороени са хора, дошли от Бран.
    И келтите, и даките бяха предимно пастоларисти.
    Друго нещо, Бран е едно от малкото имена места в Румъния, което почти сигурно е от келтски произход :).
    Бран означава Гарван на келтски езици. Или може би е случайност, кой знае.
    Направихте ли и автозомна ДНК и ако сте направили, можете ли да споделите резултатите си или просто Y ДНК и МТ-ДНК? [/ ЦИТАТ]

    In Old Slavic Bran means military action /defense/. From here in Bulgarian the word -otBrana-defense, and in Russian- oBorona /defense/. Mor- From Old East Slavic моръ (morŭ), from Proto-Slavic *morъ. In the face of a deadly disease or natural disaster that destroys many people or animals; epidemic.

  17. #42
    Regular Member Achievements:
    Veteran10000 Experience Points

    Join Date
    13-01-12
    Location
    Bucharest
    Posts
    923
    Points
    13,028
    Level
    34
    Points: 13,028, Level: 34
    Level completed: 54%, Points required for next Level: 322
    Overall activity: 4.0%

    Y-DNA haplogroup
    proly R1B

    Ethnic group
    Romanian
    Country: Romania



    Quote Originally Posted by Krum View Post
    [Цитат = mihaitzateo; 583813] О.
    Много интересно.
    Така че в Мороени са хора, дошли от Бран.
    И келтите, и даките бяха предимно пастоларисти.
    Друго нещо, Бран е едно от малкото имена места в Румъния, което почти сигурно е от келтски произход :).
    Бран означава Гарван на келтски езици. Или може би е случайност, кой знае.
    Направихте ли и автозомна ДНК и ако сте направили, можете ли да споделите резултатите си или просто Y ДНК и МТ-ДНК? [/ ЦИТАТ]

    In Old Slavic Bran means military action /defense/. From here in Bulgarian the word -otBrana-defense, and in Russian- oBorona /defense/. Mor- From Old East Slavic моръ (morŭ), from Proto-Slavic *morъ. In the face of a deadly disease or natural disaster that destroys many people or animals; epidemic.
    Well that area is a mountain area and most people there are very white skinned but mostly dark haired.
    Besides most are herding sheep and some are herding sheep and cows.
    This is not looking very Slavic like.
    Also, Alpinid is quite common in the area,as race.
    So surely they have some Celtic blood, but what kind of Celts, that is the question.

  18. #43
    Regular Member Achievements:
    250 Experience Points3 months registered

    Join Date
    07-06-19
    Location
    Bucharest
    Posts
    15
    Points
    391
    Level
    4
    Points: 391, Level: 4
    Level completed: 41%, Points required for next Level: 59
    Overall activity: 0%

    Y-DNA haplogroup
    J-L283>...>PH3514
    MtDNA haplogroup
    J1c2

    Country: Romania



    1 out of 1 members found this post helpful.
    Quote Originally Posted by Trojet View Post
    There is actually a division within J-Y40288 as suggested by scientific samples from the Phille Hallast study. As can be seen below, PH1568 is one of the upstream SNPs, so YSEQ should test you for PH3514 next.

    I have an important update for this thread: YSEQ informed me that my final haplogroup is PH3514. Any ideas how I can contribute with my result to the existent information? I mean where and how can I upload my YSEQ J2b-M12 Panel results so they can be visible on Yfull, FTDNA or other site(s) of this kind?

  19. #44
    Regular Member Achievements:
    1000 Experience Points1 year registered

    Join Date
    17-09-17
    Posts
    322
    Points
    3,441
    Level
    16
    Points: 3,441, Level: 16
    Level completed: 98%, Points required for next Level: 9
    Overall activity: 4.0%


    Country: United States



    Quote Originally Posted by telsh View Post
    I have an important update for this thread: YSEQ informed me that my final haplogroup is PH3514. Any ideas how I can contribute with my result to the existent information? I mean where and how can I upload my YSEQ J2b-M12 Panel results so they can be visible on Yfull, FTDNA or other site(s) of this kind?
    Great, congrats on determining your subclade! However, as of right now, the only way for your result to be uploaded to YFull is to do a deep test (BigY/NGS).

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •