The Celts were G2a2b2a1b L497 ( Hallstatt Y-DNA from Mitterkirchen, Upper Austria 700

That method has been roundly criticized, and for good reason, mainly because it yields wacky results that don't make any sense.
The PIE lexicon definitely seems to belong to a chalcolithic culture, one which had the wheel(neolithic Anatolia did not), and the combined weight of the archeological, genetic, and linguistic evidence does not point to an Anatolian origin for PIE, certainly not in the neolithic. There's a reason why very few scholars take the Anatolian hypothesis seriously, and, again, it's not needed to explain the presence of G in a Celtic culture.
 
I remember when in the past I had this feeling Celts would all be like R1b, G2a and some J1. :grin:
 
Last edited:
To make it clear. The only three remaining possible theories are.

1. Herders from Zagros/North Mesopotamia/East Anatolia 2. PC Steppes 3. South_Central Asia

I was always in favor of nr.1
 
The reason G2a3b1 is considered Indo European is because it's found in India, the Kalash, and Iranian people, as well as throughout Europe. It may not be a big Haplogroup but that doesn't mean it's non Indo European. Its spread is clearly of Indo European origins.
 
That method has been roundly criticized, and for good reason, mainly because it yields wacky results that don't make any sense.
The PIE lexicon definitely seems to belong to a chalcolithic culture, one which had the wheel(neolithic Anatolia did not), and the combined weight of the archeological, genetic, and linguistic evidence does not point to an Anatolian origin for PIE, certainly not in the neolithic. There's a reason why very few scholars take the Anatolian hypothesis seriously, and, again, it's not needed to explain the presence of G in a Celtic culture.
Halafian culture(mostly ENF) had the first wheels
Eneolithic began in Serbia(mostly EEF) 7000 years ago
 
Halafian culture(mostly ENF) had the first wheels
Eneolithic began in Serbia(mostly EEF) 7000 years ago

Those Halafian wheels you're referring to had to do with pottery, not quite the same thing. And in any case, that's just one thing.
Vinca, which did do some limited work with copper, was definitely a farming culture, the PIE lexicon seems to belong to a mobile, pastoralist culture. We can split hairs all day, but the weight of the evidence definitely does not favor the Anatolian theory, even Renfrew himself modified it to the point where it was practically a different thing altogether.
 
Those Halafian wheels you're referring to had to do with pottery, not quite the same thing. And in any case, that's just one thing.
Vinca, which did do some limited work with copper, was definitely a farming culture, the PIE lexicon seems to belong to a mobile, pastoralist culture. We can split hairs all day, but the weight of the evidence definitely does not favor the Anatolian theory, even Renfrew himself modified it to the point where it was practically a different thing altogether.
Funnelbeaker culture(TRB) and Maykop culture had the first wagons


Halaf->Ubaid->Tepe Gawra->Maykop
Halaf had wheels
Maykop had wagons
 
Funnelbeaker culture(TRB) and Maykop culture had the first wagons Halaf->Ubaid->Tepe Gawra->Maykop Halaf had wheels Maykop had wagons
Halaf had the potter's wheel. As for Funnelbeaker and Maikop, no arguments there, but, again, none of that points to the Anatolian hypothesis as represented by those glottochronological studies being correct.
 
this paper deals with G in austria and especially G-L497, data , maps, origins etc

http://www.blutspendezuerich.ch/Med...h resolution mapping of Y haplogroup G(2).pdf

L497 was born in Austria and it was not celtic

But wasn't the celtic branch itself born somewhere there? So why shouldn't it be possible (especially after G2a was found in the Hallstatt culture which is considered as proto_celtic) that G2a was part of the proto_celtic development. It doesn't mean that Celts were entirely G2a.
 
Last edited:
But wasn't the celtic branch itself born somewhere there? So why shouldn't it be possible (especially after the finallstatt culture which is considered as proto_celtic) that G2a was part of the proto_celtic development. It doesn't mean that Celts were entirely G2a.

celts where mainly R-U152

the G2 they had was most likely a branch from the ones recently found in the haak paper

celtic origin is where the royals tombs are ..in central germany near franfurt IIRC. but where not germans/ic



why are the celts in austria in the bronze age?
what about the helvetic people, raetic people, noricum people. they where not celts .....in swiss and austria
 
If we take the Anatolian theory then the G2a is Indo-European
While the Dene-Caucasian(Basque Etrouscan + Picts in Britain) from Siberia could be the language of R1 people
that "theory" is beyond idiotic. Sorry
 
This is an awful lot of speculation and a great deal of conflating of genes and languages.

Obviously, as has been stated both by me and by Alan, the presence of this particular G2a lineage in this culture does not mean that other lineages were not present.

As to whether this particular lineage descends from a Neolithic farmer in central Europe or originated in the east and could have been part of original Indo-European expansions, I don't know.

This is what the authors of the Wiki article have to say:
The L91 SNP that characterizes the G2a2b group was identified in spring 2009 at Family Tree DNA. G2a2b would seem to encompass a significant group of G persons. L91 is found so far in scattered parts of Europe and North Africa and in Armenia. Included within G2a2b are some men with double values for STR marker DYS19, but there are also G2a2 men with this finding who are not G2a2b. The double 19 value situation is not seen in the G2a1 and G2a3 subgroups. The L91 mutation is found at 21327383 and rs35474563 on the Y-chromosome. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. The mutation involves a change from C to T.[16] L223 is found on the Y chromosome at rs13304806.

This is a link to the FTDNA project:
https://www.familytreedna.com/public/G-YDNA/

This is all separate from discussions of the Ivanov Armenian uhrheimat vs the Pontic Caspian urheimat for the Indo-European migrations. A G2a lineage could be part of the Indo-European expansion whether or not the ultimate origin was in the Armenian highlands with the second stage in the Pontic Caspian steppe or whether the Pontic Caspian steppe is "the" ultimate origin.
 
I think that the early Kurgan people(Leila-Tepe Maykop and Kurganized Yamna) had Satem languages
Albanians + Armenians have many Z2103 and Albanians + Armenians are Satem.
Kurgan people invaded the Europe but didn't change the Languages.
Like the Satem, Sarmatians Alanians and European Huns(with Leto-Slavic or Iranian words "Med" "Strava" etc)
also invaded the Europe but didn't change the Languages


But Satem languages existed before the Kurgan people.
The ancestor cultures to Kurgan cultures are Gawra Ubaid Samarra(not to be confused to Samara) and Halaf, all four cultures were in Mesopotamia-Syria.
There is Euphratian substratum in Sumerian.
Euphratian languages possibly were IE, and possibly were ancestors of Satem languages.
Luvian languages were Satem according to some scholars, while the Hittite "newcomer" from Europe was Kentum.


About the ANE autosomal component
Caucasians Burusho Ket all are Dene-Caucasian have more ANE than others in Eurasia
From Ancient Dna we know that haplogroup R Paleolithic people had almost 100% ANE

So the G2a among Proto-Celtic Iron age people is expected
 
I have been surprised by this newthread
it is based upon only a supposedHaplogroups based itself upon an haplotype, found in aHallstatt site -
Hallstatt = place + period – here itwould be about 700 BC what is Hallstatt culture OK – but if Celtswere Y-R1b as a majority (a strong one) they could have integratedY-G2a ; that does not do Celts = Y-G2a ! - at the contrary,one could base an other theory upon this apparent local SNP and say,as it is very « highlander » regionally speaking it is THE non-I-Ean core ofRhaetic people having preceded Celts there! And if Rhaeti werelate neolithical people ? All the way all that is stillspeculation (I 'm not opposed by nature but I prefer doing bets uponmore data) - I don't speak here of the I-Ean craddle battle: no argument here to resolve this question!
I red some forumers considering Celtsappeared in History about the Iron Age in West-Central Europe – Itis true, the La Tène culture is linked to Celts –
Hallsttat = Celts ??? The wholeHallstatt culture ? Less sure !
And Celtic languages seem having beenspoken in Western Iberia before the Iron Age and the famous CentralIberia Celtiberians – Henri HUBERT was playing with the concept ofpossible Gaelic speakers in the Isles at the british Bell Beakers(Round Barrows) times, came from N-W Germany Rhine mouth -


to SILE : L247 is maybe born inAustria, maybe not, it is there it is the most frequent (but if I red well, one present in Baden culture? where in Baden ???)– but L247is the descendant of L140, « brother » to L694 and M278and found also in Northern and Western Europe – these three HaploGsare « sons » of P303, very common SNP present from Iberiato Iran if what I red was serious - what appears is it would bearrived from East across Continental Europe not across MediterraneaSea, so possible arrival among some I-Eans tribes from somewhere I donot take the risk to precise –
the L91 type and its « brother »M286 types are more certainly linked to Anatolia and MediterranianNeolithics moves – M406, « brother » to L141-1 itself« father » P303 is linked to Anatolia and Levant too butits high presence specifically in Italy could correspond to acolonization younger than Neolithic but distinct to the more widelyspred of L141-1 downtreams SNPs in Europe – M406 = Greeks ? Ora Chalcolithic (Copper) intrusion through North, from Balkans ?I lack precise local distributions an possible datations in NorthItaly and Balkan to affirm something here – but L407 is only alocal developpement of L140 from P303, not a too special branch ofmarked ethnic originality -
and SILE, Helvarti were CELTS –Rhaeti cover 2 different realities, one I-Ean, either archaïcoccidental or cCltic too, one apparently close to Etruscans...
 
The reason G2a3b1 is considered Indo European is because it's found in India, the Kalash, and Iranian people, as well as throughout Europe. It may not be a big Haplogroup but that doesn't mean it's non Indo European. Its spread is clearly of Indo European origins.

G y-dna does not have any Indo-European origins, within the historical context


it's largely from early, pre-Indo European, Neolithic settlers in Europe.


this sub-clade is just one of the Neolithic groups who mixed with the later Indo-Europeans and migrated with them,


Maciamo clearly explained the reasons for it's geographic spread.
 

This thread has been viewed 72785 times.

Back
Top